Labshake search
Citations for Addgene :
851 - 900 of 1553 citations for 5 Bromo 2 Tert Butyldimethylsilyl 4 Methylthiazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2023Quote: ... and pMD2G envelope plasmid (4 μg, a gift from Didier Trono (Addgene plasmid #12259; http://n2t.net/addgene:12259; RRID: Addgene_12259)) were transfected into HEK-293 T cells (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau and Paul Kaufman (Addgene plasmid # 17446; http://n2t.net/addgene:17446; RRID: Addgene_17446). pLenti CMV GFP Hygro (656-4 ...
-
bioRxiv - Bioengineering 2023Quote: ... followed by addition of the plasmid cocktail containing 4 µg of pMD2.G (a gift from Didier Trono; Addgene plasmid # 12259 ...
-
bioRxiv - Microbiology 2023Quote: ... hGM-CSF and hIL-4 were produced from HEK293 cells stably transduced with pAIP-hGMCSF-co (Addgene no. 74168) or pAIP-hIL4-co (Addgene no ...
-
bioRxiv - Cancer Biology 2024Quote: ... and transfected with 2.5 µg linearized RUNX1 HDR template and 4 µg each of pCW-Cas9 plasmid (Addgene, #50661) as well as two sgRNA plasmids using program CD-118 of the 4D Nucleofector system (Lonza) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 2.5 ng/mL Pmyo-2::mCherry as a co-injection marker (pCFJ90, Addgene #19327). Microinjection of adult N2 hermaph-rodites was performed as described above ...
-
bioRxiv - Bioengineering 2021Quote: ... We created 2 bacterial expression vectors: pET28-His-MBP-NLS-RfxCas13d-NLS-HA (Addgene 171586) produces the protein RfxCas13d-sTag after cleavage of the N-terminal His-MBP fusion partner ...
-
bioRxiv - Biochemistry 2021Quote: ... Individual nsp10 was expressed from plasmid SARS-CoV-2 3xFlag-nsp5CS-nsp10 (Addgene ID 169157) containing the N-terminal 3xFlag tag (MDYKDHDGDYKDHDIDYKDDDDK) ...
-
bioRxiv - Biophysics 2021Quote: The plasmid with cDNA encoding SARS-Cov-2 spike HexaPro (S) was obtained from Addgene. To express the S protein ...
-
bioRxiv - Microbiology 2021Quote: ... and pcDNA3.1 expressing SARS-CoV-2 spike gene or VSV-G (pMD2.G, Addgene #12259) using VigoFect (Vigorous Biotechnology) ...
-
bioRxiv - Molecular Biology 2022Quote: ... a 2 mL transfection mixture containing lentiviral packaging plasmids 7.5 µg pMD2.G (#12259, Addgene), 11.4 µg pMDLg-RRE (#12251 ...
-
bioRxiv - Cancer Biology 2022Quote: ... The HN30 and HN31 cell lines were transfected with 2 μg mCherry (Addgene, Plasmid 41583) as a negative control ...
-
bioRxiv - Genetics 2020Quote: ... we used an existing CMV-driven SARS-CoV-2 plasmid (pcDNA3.1-SARS2-Spike, Addgene 145032)(Shang et al. ...
-
bioRxiv - Microbiology 2021Quote: ... and pcDNA3.1 expressing SARS-CoV-2 spike gene or VSV-G (pMD2.G (Addgene #12259)) using VigoFect (Vigorous Biotechnology) ...
-
bioRxiv - Microbiology 2021Quote: ... by flow cytometry on HEK293-FT cells transiently expressing SARS-CoV-2 N (Addgene # 141391), S (BEI # NR-52310 ...
-
bioRxiv - Microbiology 2021Quote: The plasmid encoding SARS-CoV-2 S HexaPro was a gift from Jason McLellan (Addgene plasmid # 154754 ...
-
bioRxiv - Neuroscience 2022Quote: ... One microliter of endo-free purified (2 ug/ul) pCAG-EGFP plasmid (Addgene, cat# 89684) mixed with 0.05% Fast Green (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... to co-transfect plasmids containing cDNAs for SARS-CoV-2 E protein (pGBW-m4133502, Addgene) and green fluorescent protein (GFP ...
-
bioRxiv - Neuroscience 2023Quote: ... Retro-AAV2 coding for mCherry (pAAV2-hSyn-mCherry, Addgene #114472, 2 x 1013 GC/ml) and green fluorescent protein (pAAV2-hSyn-eGFP ...
-
bioRxiv - Microbiology 2022Quote: ... 500 ml LB culture of pCDFDuet-1-6×His-SARS-CoV-2-NSP7/NSP8 (Addgene)-transformed E.coli BL21 DE3 strain was induced by isopropyl β-d-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Microbiology 2022Quote: ... pTwist-EF1alpha-SARS-CoV-2-S-2xStrep (a gift from Nevan Krogan, Addgene plasmid # 141382) was used to express S-protein from the original SARS-CoV-2 strain (WT) ...
-
bioRxiv - Molecular Biology 2024Quote: Neurogenin 2 (NGN2) was expressed in iPSC lines using a tetracycline inducible promoter (Addgene 172115) integrated using Piggybac plasmid EFa1-Transposase (Addgene plasmid 172116 ...
-
bioRxiv - Immunology 2024Quote: ... The plasmid pcDNA3.1 SARS-CoV-2 S D614G was a gift from Jeremy Luban (Addgene plasmid # 158075 ...
-
bioRxiv - Microbiology 2024Quote: ... The plasmid pcDNA3.1 SARS-CoV-2 S D614G was a gift from Jeremy Luban (Addgene plasmid # 158075 ...
-
bioRxiv - Biochemistry 2024Quote: ... two all-in-one CRISPR-Cas9 vectors were generated from pX330A-1×2 (58766, Addgene) and pX330S-2-PITCh (63670 ...
-
bioRxiv - Cell Biology 2023Quote: ... The cells were co-transfected with 2 μg lentivirus packaging plasmids (pMD2.G (Addgene #12259) and 10 μg psPAX2 (Addgene #12260) ...
-
bioRxiv - Molecular Biology 2023Quote: 2 µg total of multiplex sgRNA vector and EF1α-dCas9-VPR-Puro vector (Addgene #99373) at a 2:1 molar ratio were mixed with 5 µl of Lipofectamine 2000 (Thermo ...
-
bioRxiv - Biophysics 2022Quote: SARS-CoV-2 S HexaPro plasmid was a gift from Jason McLellan (Addgene plasmid # 154754). This plasmid contains CMF promotor driven expression of the SARS-COV-2 Spike-B.1 ectodomain (1-1208 AAs ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... encoding the Luc mRNA with the SARS-CoV-2 packaging signal in 3’-UTR (Addgene), were co-transfected with plasmids expressing the SARS-CoV-2 nucleocapsid (nCoV-2-N) ...
-
bioRxiv - Genomics 2023Quote: ... guide pair 2: TTGCGGCGCTGTGGCGCCGA and CGCTCCCGCAAGTGGATGTC) and were cloned into the pX458 plasmid (Addgene, #48138) as previously described [49] ...
-
bioRxiv - Neuroscience 2023Quote: ... we infected organoids for 2 weeks with the AAV1-hSYN-eGFP virus (Addgene, 105539-AAV1), which directs expression of eGFP under the neuron-specific synapsin promoter ...
-
bioRxiv - Neuroscience 2023Quote: ... USA) and [2] a Cre-dependent virus expressing green fluorescent protein (AAV-Flex-GFP; Addgene) or diphteria toxin (AAV2/9-EF1a-mCherry-Flex-dTA ...
-
bioRxiv - Biochemistry 2023Quote: ... pEvol-pAzFRS.2.t1 was a gift from Farren Isaacs [Amiram et al 2017] (Addgene plasmid # 73546 ...
-
bioRxiv - Biochemistry 2023Quote: ... coli BL21 (DE3) cells using the plasmid pRSFDuet-1/CylLL/CylM-2 (Addgene ID #208759), following the method previously reported.9 For the preparation of lanthionine standard ...
-
bioRxiv - Neuroscience 2024Quote: ... cohort 1) or AAV9.EF1a.dflox.hChR2(H134R).mCherry.WPRE.HGH (1×10^12 pp/mL, Addgene, cohort 2).
-
bioRxiv - Cell Biology 2024Quote: ... The sgRNA sequences (Extended Data Table 2) were inserted into the pDD162 vector (Addgene #47549) by linearizing the vector with 15 base pairs (bp ...
-
bioRxiv - Neuroscience 2024Quote: ... neurons were infected with either AAV5-hSyn-GCaMP6f (2 uL per dish; Addgene 100837-AAV5) or AAV2/1-hSyn-FLiCRE viruses (300 uL per dish ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... cells were co-transfected with enveloping (pCMV14-3X-Flag-SARS-CoV-2 S (Addgene #145780) for PVs or pMD2.G (Addgene #12259 ...
-
bioRxiv - Cell Biology 2024Quote: ... and Cas9 (modified based on pX330A-1x2, Addgene #58766, and pX330S-2-PITCh, Addgene #63670) (Sakuma et al. ...
-
bioRxiv - Bioengineering 2024Quote: For transgene expression studies with AAV vectors we used the following AAV expression plasmid:pAAV/mIba1.GFP.WPRE.miR-9.T.miR-129-2-3p.T.SV40pA was a gift from Hirokazu Hirai (Addgene plasmid # 190163 ...
-
bioRxiv - Neuroscience 2021Quote: ... working dilution 1:5) was a gift from Douglas Kim (Addgene viral prep #100833-AAV9; http://n2t.net/addgene:100833; RRID:Addgene_100833). pAAV5-hSyn-dLigh1.2 (titer ≥ 4×1012 vg/ml ...
-
bioRxiv - Cell Biology 2020Quote: ... was generated by ligating oligonucleotides containing the targeting sequence 5’-CAGTTCCTGGGTGGAGCTA-3’ into pLKO.1-puro (Addgene # 8453). The mitochondrial (CMV-mitoCAR-GECO1 ...
-
bioRxiv - Cell Biology 2021Quote: ... For the Tg(fliEP:loxRFPlox:DNtal) construct the 5’ entry clone 478 p5Efli1ep was a gift from Nathan Lawson (Addgene plasmid # 31160 ...
-
bioRxiv - Cell Biology 2021Quote: ... The resulting scFv fragments were further amplified using the 5’ and 3’ primers (scFv primer_s and scFv primer_as) and cloned into the psfGFP-N1 vector (Addgene #54737 ...
-
bioRxiv - Systems Biology 2022Quote: A Myd88-targeting guide RNA (5’-TCGCGCTTAACGTGGGAGTG-3’) was cloned into the pX330 plasmid backbone (Addgene Plasmid #42230) and transfected using electroporation (Lonza ...
-
bioRxiv - Neuroscience 2020Quote: ... The entire coding sequence of GCaMP6s was amplified by PCR with primers 5’–GGATCCGCCACCATGGGTTCTCATCATCATCA–3’ and 5’–GTAGCCGAACCGGTCTTCGCTGTCATCATTTGTAC–3’ using pGP-CMV-GCaMP6s (Addgene plasmid # 40753; http://n2t.net/addgene:40753; RRID:Addgene_40753) as a template ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV-hSyn1-GCaMP6s-P2A-nls-dTomato (serotype AAV1, viral titer ≥ 5×1012 vg/mL; Addgene, Watertown, MA, USA), pAAV-hSyn-hM4D(Gi)-mCherry (serotype AAV retrograde ...
-
bioRxiv - Microbiology 2022Quote: ... The target sequence for the ACE2 gene (5′-TGCTGCTCAGTCCACCATTG-3′) was designed using CRISPR direct (https://crispr.dbcls.jp) and cloned into plentiCRISPR plasmids (21) (Addgene plasmid #52961 ...
-
bioRxiv - Neuroscience 2022Quote: ... 238 μg rep-cap plasmid encoding AAV5 capsid proteins (pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964 ...
-
bioRxiv - Neuroscience 2022Quote: ... 238 μg rep-cap plasmid encoding AAV5 capsid proteins (pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964 ; http://n2t.net/addgene:104964 ; RRID:Addgene_104964) and 64.6 μg of either the CalEx plasmid (pZac2.1-GfaABC1D-HA-hPMCA2w/b ...