Labshake search
Citations for Addgene :
51 - 100 of 1416 citations for Adenovirus Type 5 Particles CMV β galatosidase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... pBMN (CMV-copGFP-Luc2-Puro) (Addgene) was stably transfected into control and RIPK2-KO 22Rv1 cells ...
-
bioRxiv - Developmental Biology 2020Quote: ... or pLenti CMV PURO DEST (Addgene) using Gateway recombination cloning methods (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2019Quote: ... pN1-CMV-TFEB-GFP (Addgene # 38119). Newly cloned episomal plasmids were then additional cloned into lentivector backbone ...
-
bioRxiv - Developmental Biology 2020Quote: ... or pLenti CMV PURO DEST (Addgene) using Gateway recombination methods (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... CMV-GFP-NMHC IIA (Addgene #11347) and CMV-GFP-NMHC IIB (Addgene #11348 ...
-
bioRxiv - Immunology 2020Quote: ... plasmid pLenti-CMV Puro-Luc (Addgene), and pcDNA3.1-SARS-CoV-2 SΔCT (deletion of the cytoplasmic tail ...
-
bioRxiv - Cancer Biology 2020Quote: ... CMV-VSV-G (Addgene plasmid #8454) and psPAX2 (Addgene plasmid #12260 ...
-
bioRxiv - Molecular Biology 2023Quote: – CMV-Flag-GFP (Addgene plasmid #60360).
-
bioRxiv - Cell Biology 2023Quote: ... plasmids pCDNA3.1(+)-CMV-βarrestin2-TEV (Addgene plasmid #107245 ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV8-CMV-eGFP-WPRE (Addgene viral prep #105530-AAV8 gifted by James M ...
-
bioRxiv - Biochemistry 2023Quote: ... pLenti-CMV-Hygro (w117-1) (Addgene, 17454 a gift from Eric Campeau & Paul Kaufman) ...
-
bioRxiv - Neuroscience 2020Quote: ... The entire coding sequence of GCaMP6s was amplified by PCR with primers 5’–GGATCCGCCACCATGGGTTCTCATCATCATCA–3’ and 5’–GTAGCCGAACCGGTCTTCGCTGTCATCATTTGTAC–3’ using pGP-CMV-GCaMP6s (Addgene plasmid # 40753; http://n2t.net/addgene:40753; RRID:Addgene_40753) as a template ...
-
bioRxiv - Immunology 2019Quote: ... We used the resulting virus particles to transduce immortalized wild-type C57BL/6 cells that express doxycycline-inducible SpCas9 enzyme (generated using Addgene plasmid #50661). We cultured transduced cells in 3.0 μg/ml blasticidin (Invivogen ...
-
bioRxiv - Cell Biology 2021Quote: ... pGP-CMV-GCaMP6s was generated by deleting the CAAX sequence from pGP-CMV-GCaMP6s-CAAX (Addgene, #52228). To construct the expression plasmid pIRES2-mCherry ...
-
bioRxiv - Cancer Biology 2022Quote: Lentiviral particles from plentiCRISPRv2 and retroviral particles from pBabe-hygro-GFP (RRID:Addgene_61215) were produced in 293T cells as described26,27 ...
-
bioRxiv - Neuroscience 2021Quote: ... C57BL/6 mice were injected with the AAV5-CAG-ChR2-mCherry adenovirus (200 nL, Addgene) in the PC ...
-
bioRxiv - Biophysics 2021Quote: ... and CMV-GFP-NMHC IIB (Addgene #11348) were gifts from Robert Adelstein (Wei and Adelstein ...
-
bioRxiv - Microbiology 2022Quote: ... The pLenti-CMV-GFP-Puro (Addgene, 17448), pLenti-CMV-Luc-Puro (Addgene ...
-
bioRxiv - Microbiology 2022Quote: ... pLenti CMV Puro LUC (Addgene plasmid #17477) and pLenti CMV Puro GFP (Addgene plasmid #17448 ...
-
bioRxiv - Cell Biology 2021Quote: ... the SED1 construct was first subcloned into EcoRV-HF (NEB)-digested pLenti-CMV Puro DEST (Addgene #17452) using the NEBuilder HiFi DNA Assembly master mix (NEB) ...
-
bioRxiv - Cell Biology 2021Quote: ... and CMV-GFP-NMHC IIB (Addgene #11348) were gifts from Robert Adelstein (Wei and Adelstein ...
-
bioRxiv - Immunology 2020Quote: ... and pLenti CMV Hygro DEST (Addgene, #17454) respectively ...
-
bioRxiv - Microbiology 2022Quote: ... into pDEST-CMV-N-EGFP (#122842, Addgene). pCMV-EGFP-ORF3a-Q57E-S58L-Q116L was constructed as described(Yang et al. ...
-
bioRxiv - Genomics 2023Quote: pLenti CMV GFP Puro (Addgene, plasmid #17448) plasmid was cut with BsrgI and SalI restriction enzymes ...
-
bioRxiv - Cancer Biology 2023Quote: ... Transposon plasmid (PT4-CMV-GFP (Addgene #11704), PT4-U6-sgRNA-CMV-GFP ...
-
bioRxiv - Molecular Biology 2023Quote: ... p2T-CMV-BE4max-BlastR (Addgene no. 15299120) was used for cytosine base editing ...
-
bioRxiv - Immunology 2023Quote: ... pLenti CMV rtTA3 Blast (Addgene w756-1) stably expressing clonal RAW MΦs were transduced with pLenti CMV Puro DEST (Addgene w118-1 ...
-
bioRxiv - Cell Biology 2023Quote: ... pTrip-CMV-GFP-Flag-cGas (Addgene 86675); pLBS.CAG-NLS-mScarlet (Addgene 129336) ...
-
bioRxiv - Cell Biology 2024Quote: ... into pLenti CMV Hygro DEST (Addgene 17454). We generated stable cells lines using these constructs via lentiviral delivery and antibiotic selection ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and transfer (pHR-CMV-GFP, Addgene #14858) plasmids ...
-
bioRxiv - Cancer Biology 2024Quote: ... and pLVpuro-CMV-N-mCherry (Addgene, #123221) for lentiviral expression ...
-
bioRxiv - Cell Biology 2024Quote: ... The CMV promoter of mEmerald-C1 (Addgene plasmid # 53975 ...
-
bioRxiv - Cell Biology 2020Quote: ... pLV-CMV-LoxP-DsRed-LoxP-eGFP and pcDNA3.1-CMV-CFP;UBC-Cre25nt (RRID:Addgene_65726, RRID:Addgene_65727, gift from J. van Rheenen15). GFP-CD63 was obtained with sequential subcloning of the CD63 cDNA in the vector pCDNA5/FRT/TO followed by in-frame 5’-insertion of the GFP cDNA with HindIII/BlpI ...
-
bioRxiv - Synthetic Biology 2023Quote: ... This coding sequence was inserted behind the CMV promoter within the pLenti CMV/TO Puro DEST lentiviral vector (Addgene plasmid #17293 ...
-
bioRxiv - Neuroscience 2024Quote: Following plasmids were used for transfection pN1-CMV-sDarken (Addgene plasmid #184799, pN1-CMV-L-sDarken (Addgene plasmid #184800), null-mutant of sDarken (created in house) ...
-
bioRxiv - Bioengineering 2019Quote: cDNA for pLenti CMV GFP Puro (658-5) was a gift from Eric Campeau and Paul Kaufman (Addgene plasmid #1744856). To generate lentivirus ...
-
bioRxiv - Cell Biology 2021Quote: ... The adenovirus plasmid encoding EGFP-tubulin (pShuttle-EGFP-tubulin) was a gift from Torsten Wittmann (Addgene plasmid #24327 ...
-
bioRxiv - Cancer Biology 2021Quote: ... HT-1080N cells were transduced with lentiviruses carrying the reverse tetracycline-controlled transactivator 3 under a CMV promoter (CMV-rtTA3) (Cat# w756-1, Addgene). HT-1080N-rtTA3 cell lines were selected in 10 μg/mL blasticidin (Cat # A1113902 ...
-
bioRxiv - Cell Biology 2020Quote: ... and further subcloned into a CMV driven vector (pLenti CMV V5-LUC Blast (w567-1) was a gift from Eric Campeau (Addgene plasmid #21474 ...
-
bioRxiv - Neuroscience 2020Quote: ... and jRGECO1a(Dana et al. 2016) were first amplified by PCR from pGP-CMV-GCaMP6f and pGP-CMV-NES-jRGECO1a (Addgene) with 5’ BamHI and 3’ HindIII ...
-
bioRxiv - Cell Biology 2021Quote: ... Exogenous cells - MDCK cells were mosaically transfected using a CMV GFP vector (pLenti CMV GFP Blast (659-1) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid #17445 ...
-
Ribonuclease Inhibitor and Angiogenin collaboratively regulate cell-type-specific global translationbioRxiv - Biochemistry 2024Quote: RNH1-KO K562 cells were infected with lentiviruses expressing ANG (pLenti CMV Blast GFP-ANG) or the empty vector pLenti CMV Blast DEST (706-1, Addgene) as previously described 52 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and pPRIME-CMV-NEO-recipient (CTRL, Addgene, #11659). For β-Catenin shRNA mediated silencing ...
-
bioRxiv - Genetics 2021Quote: ... and 1 μg CMV-SB10 (Addgene plasmid # 24551) via the tail vein in 5-7 s ...
-
bioRxiv - Microbiology 2022Quote: ... luciferase reporter plasmid pLenti-CMV Puro-Luc (Addgene) and spike protein expressing pcDNA3.1-SARS-CoV-2 SΔCT were co-transfected into HEK293T cells (ATCC CRL_3216 ...
-
bioRxiv - Microbiology 2021Quote: ... luciferase reporter plasmid pLenti-CMV Puro-Luc (Addgene) and S protein expressing pcDNA3.1-SARS CoV-2 S.dCT were co-transfected into HEK293T cells using lipofectamine 2000 (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were transfected with CMV-R_GECO (Addgene #45494) (Wu et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... lentiviral vectors pLenti-CMV-TetR-Blast (17492, Addgene) and pLenti-CMV/TO-Neo-Dest (17292 ...
-
bioRxiv - Cell Biology 2021Quote: ... and pLenti-CMV/TO-Neo-Dest (17292, Addgene) were used ...
-
bioRxiv - Cancer Biology 2020Quote: ... Lentiviral plasmid pCDH-CMV-MCS-EF1-Puro (Addgene) was used for overexpression of human TAO3-SR (shRNA resistant) ...