Labshake search
Citations for Addgene :
1 - 50 of 1416 citations for Adenovirus Type 5 Particles CMV β galatosidase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... The adenovirus was constructed by subcloning the existing E-cadherin tension sensor into the pShuttle-CMV vector (Addgene, 16403), followed by recombination into the pAdEasy1 vector (Addgene ...
-
bioRxiv - Neuroscience 2021Quote: AAV9-particles were synthesized usingpAAV-U6-sgRNA-CMV-eGFP and pAAV-RSV-spCas9 (Addgene plasmids #85451 and 85450 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... β-arrestin 2 was amplifying from pCDNA3.1(+)-CMV-bArrestin2-TEV (Addgene #107245) with Gibson Assembly primers compatible with the NEBuilder HiFi DNA Assembly Kit (New England BioLabs ...
-
bioRxiv - Neuroscience 2021Quote: ... adenovirus helper plasmid pAdDeltaF6 (Addgene 112867) and pAAV-hSyn-EGFP (Addgene 50465) ...
-
bioRxiv - Cell Biology 2022Quote: ... Plasmid mixes to produce HIV-1 viral particles consisted of 0.4 μg CMV-VSVG (pMD2.G; 12259; Addgene) and 2.6 μg of HIV proviral plasmid ...
-
bioRxiv - Cell Biology 2023Quote: ... Wild-type and Fam134s KO MEFs were infected with pCW57-CMV-ssRFP-GFP-KDEL (Addgene #128257) in order to generate ER-phagy reporter inducible cell lines ...
-
bioRxiv - Molecular Biology 2023Quote: ... wild-type MEFs were transduced with lentiviral particles containing the plasmids lentiMPHv2 (Addgene #89308) and lentiSAMv2 (Addgene #75112) ...
-
bioRxiv - Genetics 2023Quote: ... an adenovirus helper plasmid (pAdΔF6; Addgene plasmid 112867), and an ITR-flanked AAV transgene expression plasmid AAV-CAG-eGFP (provided by Dr ...
-
bioRxiv - Cell Biology 2022Quote: - AoSMC Inducible progerin-expressing cells: Lentiviral particles containing pLenti-CMV-TRE3GNeo-GFP progerin (gift from Tom Misteli (Addgene plasmid # 118710), pLentiCMV-TRE3G-GFP-laminA (gift from Tom Misteli (Addgene plasmid # 118709)) ...
-
bioRxiv - Bioengineering 2020Quote: ... either of the two cell types was subjected to Lipofectamine transfection with CMV-R-GECO1.2-mCherry (Addgene, Watertown ...
-
bioRxiv - Microbiology 2020Quote: ... This vector expresses an endoplasmic reticulum (ER)-retained truncated Env-EGFP fusion protein. For linearization experiments (Fig. 5) we used plasmid pNL-EGFP/CMV/WPREdU3 (pNL-CMV-GFP) (Addgene, MA, USA). pNL4-3/Luc/Ori and pNL4-3/Luc/Kan were produced by molecular cloning into pNL4-3/Luc ...
-
bioRxiv - Microbiology 2022Quote: HK1 cells that stably express GFP-LMP1 under control of a tetracycline-inducible promoter were created by first being transduced with lentivirus particles containing pLenti CMV TetR BLAST (Addgene; 17492) as previously described in (18) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and a WPRE (cloned from pLenti CMV GFP Puro (658-5) (Addgene #17448)) all flanked by epigenetic insulator sequences by repetitive restriction digests (KflI-EcoRI ...
-
bioRxiv - Microbiology 2021Quote: Cells stably expressing shRNA of different genes under the control of a tetracycline-inducible promoter were created by first transducing SNB-19 cells with lentivirus particles containing pLenti CMV TetR BLAST (Addgene; number 17492). The cells underwent selection with media containing 10 μg/mL of blasticidin (Invivogen ...
-
bioRxiv - Neuroscience 2021Quote: ... and inserted a strong CAG promoter (CMV immediate early enhancer/modified chicken β-actin promoter, from Addgene Plasmid #1378) in front of the FLEX-cassette to create pRMCE-CAG-Flex ...
-
bioRxiv - Cell Biology 2022Quote: ... Enhanced GFP (EGFP) was PCR cloned from pLenti CMV GFP Puro (Addgene 658-5) with primers CTCGTCGACCATGGTGAGCAAGGG and CTCGGATCC CGTTACTTGTACAGCTCGT and cloned into hIL8-pCHD at the SalI and BamHI restriction sites.
-
bioRxiv - Biochemistry 2022Quote: ... These GFP positive cells were transduced with lentiviral particles for pLenti CMV rtTA3 Hygro (w785-1) (a gift from Eric Campeau Addgene plasmid number 26730) for tetracycline inducible expression and selected using hygromycin (200μg/ml) ...
-
bioRxiv - Neuroscience 2022Quote: ... This construct was generated from a plasmid that contained a wild-type (WT) rat Nfasc gene expressed from the cytomegalovirus (CMV) promoter (a gift from Vann Bennett, Addgene plasmid # 31061 ...
-
bioRxiv - Molecular Biology 2020Quote: ... pShuttle-CMV (Addgene #16403) and AdEasier-1 cells (#16399 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... CMV-SEAP (Addgene #24595) was used to constitutively express SEAP in MKs ...
-
bioRxiv - Neuroscience 2020Quote: ... The entire coding sequence of GCaMP6s was amplified by PCR with primers 5’–GGATCCGCCACCATGGGTTCTCATCATCATCA–3’ and 5’–GTAGCCGAACCGGTCTTCGCTGTCATCATTTGTAC–3’ using pGP-CMV-GCaMP6s (Addgene plasmid # 40753 ...
-
bioRxiv - Immunology 2022Quote: ... pLenti CMV GFP Puro (658-5) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17448 ...
-
bioRxiv - Bioengineering 2022Quote: ... pLenti CMV GFP Puro (658-5) was a gift from Eric Campeau & Paul Kaufman (RRID:Addgene_17448)[33] ...
-
bioRxiv - Cell Biology 2020Quote: ... Wild-type β-PheRS cDNAs were cloned into the pET LIC (2A-T) plasmid (Addgene). Then ...
-
bioRxiv - Cell Biology 2020Quote: ... pLV-CMV-LoxP-DsRed-LoxP-eGFP and pcDNA3.1-CMV-CFP;UBC-Cre25nt (RRID:Addgene_65726 ...
-
bioRxiv - Cancer Biology 2022Quote: Polyclonal SK-N-DZ cells constitutively expressing the CRISPR activation machinery were engineered by transducing wild-type cells with lentiviral particles carrying a dCas9-VP64 (lenti dCas9VP64_Blast, Addgene plasmid #61425 was a gift from Feng Zhang ...
-
bioRxiv - Cancer Biology 2022Quote: ... SKOR1-shRes-WT and -Y234F were then recombined into pLenti CMV-GFP (658-5) (Addgene; 17448). For transduction of the above mentioned constructs ...
-
bioRxiv - Molecular Biology 2023Quote: ... (ABE8e: p2T-CMV-ABE8e-SpCas9-BlastR, BE4max: p2T-CMV-BE4max-BlastR (Addgene no. 152991), Cas9 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The MSCV-CMV-CMV-Flag-HA-JMJD6 was purchased from Addgene (Addgene # plasmid 31358). The retrovirus packaging was done as described in the following procedure ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLenti CMV Puro DEST (Addgene) for subsequent use.
-
bioRxiv - Cancer Biology 2022Quote: ... pLenti CMV Puro DEST (Addgene). The plasmid was validated by DNA sequencing (Eurofins) ...
-
bioRxiv - Cell Biology 2019Quote: ... pLenti-CMV-rtTA3 Hygro (Addgene plasmid #26730 ...
-
bioRxiv - Cell Biology 2021Quote: ... pLenti-CMV-Puro DEST (Addgene plasmid #17452 ...
-
bioRxiv - Neuroscience 2022Quote: ... pBS- CMV-gagpol (Addgene #35614) and phCMV using TransIT ...
-
bioRxiv - Cancer Biology 2022Quote: CMV pCalpain-sensor (Addgene #36182) composed of eCFP (donor ...
-
bioRxiv - Microbiology 2020Quote: ... pAdTrack-CMV (Addgene plasmid #16405) and AdEasier-1 cells (Addgene #16399 ...
-
bioRxiv - Cell Biology 2020Quote: ... into pShuttle-CMV (Addgene, #16403). PShuttle-CMV plasmids were then digested overnight with MssI (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... pBS-CMV-gagpol (Addgene #35614) and pMRX-IP-HaloTag7-LC3 (Addgene #184899 ...
-
bioRxiv - Cancer Biology 2023Quote: ... into pCDH-CMV (Addgene, 72265) using BamHI and NotI restriction sites and HIF2α mutant from the pBabe retroviral vector into pCDH-CMV using BamHI and SalI sites.
-
bioRxiv - Cancer Biology 2023Quote: ... pHAGE-CMV-eGFP (Addgene #196046), lentiCRISPRv2 (Addgene plasmid #52961) ...
-
bioRxiv - Immunology 2023Quote: ... pLenti-CMV Puro-Luc (Addgene), and pcDNA3.1-SARS-CoV-2 S plasmids were co-transfected into HEK-293T cells ...
-
bioRxiv - Neuroscience 2023Quote: ... pGP-CMV-GCaMP6s69 (Addgene 40753) was used as a template and 3 primers were used in a Q5 PCR (15 cycles at 71° C and 20 cycles at 72° C ...
-
bioRxiv - Immunology 2021Quote: ... pLenti CMV-GFP-TAV2A-LUC Hygro was generated from pLenti CMV GFP Hygro (Addgene #17446) by addition of T2A-Luciferase by PCR cloning ...
-
bioRxiv - Cell Biology 2023Quote: ... pLenti CMV GFP Puro (658-5) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid #17448). mito-BFP was a gift from Gia Voeltz (Addgene # 49151) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cyclin D3 cDNA was cloned out of Rc/CMV cyclin D3 (CMV promoter; #10912 from Addgene) with PCR using the primers listed in Table 1 and cloned into pmCherry-C1 (CMV promoter ...
-
bioRxiv - Cell Biology 2023Quote: ... CMV-LoxP-DsRed-LoxP-GFP was amplified from pLV-CMV-LoxP-DsRed-LoxP-GFP (Addgene #65726) (Zomer et al. ...
-
bioRxiv - Biophysics 2021Quote: ... CMV-GFP-NMHC IIA (Addgene #11347) and CMV-GFP-NMHC IIB (Addgene #11348 ...
-
bioRxiv - Microbiology 2022Quote: ... pLenti-CMV-Luc-Puro (Addgene, 17477), Lenti-4EHP (Sigma ...
-
bioRxiv - Bioengineering 2022Quote: ... MLV-CMV-Luciferase plasmid (Addgene, 170575), and SARS-CoV-2-d18 (Genbank MN908947 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The Cre-containing plasmid was obtained from Addgene (pLM-CMV-R-Cre, Addgene #27546). A fragment encoding the CMV promoter and mCherry-T2A-Cre-WPRE was excised by NdeI and SacII (Thermo Fisher Scientific ...