Labshake search
Citations for Addgene :
701 - 750 of 2026 citations for Human Chemokine C X C Motif Receptor 5 CXCR5 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... AAV2/5-GfAABC1D-hM3Dg-mCherry (Addgene; RRID:Addgene_50478), AAV-CMV-Aldh1a1-shRNA (Stanford ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV2/5-GfAABC1D-hM3Dg-mCherry (Addgene; RRID:Addgene_50478), AAV-CMV-Aldh1a1-shRNA (Stanford ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmids pLVX-EF1alpha-SARS-CoV-2-proteins-2xStrep-IRES-Puro proteins are a gift from Nevan Krogan (Addgene)(Gordon ...
-
bioRxiv - Genomics 2019Quote: ... we cloned the effector proteins (PguCas13b: Addgene 103861 ...
-
bioRxiv - Molecular Biology 2020Quote: ... envelope protein plasmid (pMD2.G, Addgene #12259), REV-expressing plasmid (pRSV-Rev ...
-
bioRxiv - Cell Biology 2021Quote: ... and envelope encoding protein (VSVG; Addgene # 8454). Lentiviral particles were collected after 48 hrs of transfection and were used for transducing target cell lines.
-
bioRxiv - Cell Biology 2020Quote: ... or a fluorescent protein (pCDNA3-GFP; Addgene plasmid #74165 or mCherry2-N1 ...
-
bioRxiv - Biochemistry 2023Quote: ... and YFP tagged recombinant proteins (Addgene #173080), genes were inserted between N-terminal 6x His-tag followed by CFP/YFP tag and a TEV protease cleavage site of pNIC28-Bsa4 ...
-
bioRxiv - Biochemistry 2024Quote: ... envelope protein-pCMV-VSV-G (Addgene #8454), packaging plasmid - pCMV-dR8.2 dvpr (Addgene #8455 ...
-
bioRxiv - Cancer Biology 2022Quote: ... was co-transfected into 80% confluent lenti-X 293T cells with 4.8 μg psPAX2 (Addgene) and 3.2 μg pMD2.G (Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV vectors encoding ChR2(H134R)-eYFP (titer = 1 x 1012 vg/ml, Addgene 26973, RRID:Addgene_127090) were stereotaxically injected into and centered at the temporal association cortex (TeA ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV vectors encoding ChR2(H134R)-eYFP (titer = 1 x 1012 vg/ml, Addgene 26973, RRID:Addgene_127090) were stereotaxically injected into and centered at the temporal association cortex (TeA ...
-
bioRxiv - Neuroscience 2021Quote: ... EnvA-Rab-pSADΔG-mCherry (Fig. 5A, Salk Vector Core; 1.0 x 109; Addgene plasmid #32636); EnvA-Rab-CVS-N2cΔG-H2B-EGFP (Fig ...
-
bioRxiv - Neuroscience 2023Quote: ... Retro-AAV2 coding for mCherry (pAAV2-hSyn-mCherry, Addgene #114472, 2 x 1013 GC/ml) and green fluorescent protein (pAAV2-hSyn-eGFP ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 x 105 cells from the previous transfection were transfected with pCMV-PEmax (Addgene: 174820)11 (800 ng ...
-
bioRxiv - Neuroscience 2023Quote: ... cre-dependent AAV9-hSyn-FLEX-GCaMP6s-WPRE-SV40 (∼2.0 x 1012 vg/ml; Addgene #100845) was injected unilateral into the VTA (Coordinates ...
-
bioRxiv - Neuroscience 2023Quote: ... cre-dependent AAV9-hSyn-FLEX-GCaMP6s-WPRE-SV40 (∼2.0 x 1012 vg/ml; Addgene #100845) was bilaterally injected into the ARC (Coordinates ...
-
bioRxiv - Cell Biology 2023Quote: ... Lentiviruses were produced by transfecting Lenti-X 293T cells with pMD2.VSVG (Addgene plasmid # 12259) and psPAX2 (Addgene plasmid # 12260).
-
bioRxiv - Neuroscience 2023Quote: ... where an AAV vector for the expression of the recombinase Cre (pENN.AAV.CAMKII0.4.Cre.SV40, Cat. Number #105558-AAV1, titre 1.9 x 1013, Addgene) was injected in utero into the ventricle of the embryonic brain (as described in Donato et al ...
-
bioRxiv - Neuroscience 2024Quote: ... plus either AAV8-hSyn-DIO-hM4Di-mCherry (2.2 x 1013 GC/mL, Addgene, Watertown, MA) or AAV8-hSyn-DIO-mCherry (Control virus ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV1/5-CamKIIahChR2(H134R)-eYFP or AAV1/5-CamKIIa-eYFP (AAV5: from UNC GTC Vectore Core; AAV1: from Addgene) was injected bilaterally in mPFC under stereotaxic guidance at 2.2 mm anterior and 0.3 mm lateral to bregma and 1.6 mm ventral to the skull ...
-
bioRxiv - Neuroscience 2022Quote: ... The cDNA of Ncam2.1 was amplified from the pCNcam2.1 with 5’-ACCATGAGCCTCCTCCTCTCC-3’ and 5’-CTGACCAAGGTGCTGAAACT-3’and cloned into pWPI (Plasmid #12254, Addgene) within PmeI site to obtain the pWPI-NCAM2.1 ...
-
bioRxiv - Neuroscience 2022Quote: ... The cDNA of Ncam2.2 was amplified with 5’-ACCATGAGCCTCCTCCTCTCC-3’ and 5’-TCTCTGATCAGGGAGTACCA-3’ and cloned into pWPI (Plasmid #12254, Addgene) within PmeI site to obtain the pWPI-NCAM2.2.
-
bioRxiv - Systems Biology 2019Quote: ... A20-targeting guide RNAs (5’ – CACCGTTTGCTACGACACTCGGAAC – 3’, and 5’ – CACCGCTCGGAACTTTAAATTCCGC – 3’) were cloned into lentiCRISPR v2 (Addgene Plasmid #52961)48 and used for lentivirus production in HEK293T cells ...
-
bioRxiv - Neuroscience 2019Quote: ... 5 µl of pre-diluted AAV8-p4BDNF-ERT2CreERT2 was mixed with 5 µl of AAV8-CAG-FLEX-tdTomato (Addgene) and 5 µl of AAV1-hSyn-eGFP-WPRE-bGH (Addgene ...
-
bioRxiv - Genetics 2023Quote: ... GFP-3’UTR was PCR amplified using primers (5’-AGCTTGCATGCCTGCAGGTCG-3’ and 5’-AAGGGCCCGTACGGCCGACTA-3’) and plasmid pPD95.75 (Plasmid #1494-Addgene) as the template ...
-
bioRxiv - Molecular Biology 2021Quote: A codon adapted version of human DUX4 (pCW57.1-DUX4-CA, Addgene plasmid #99281) was cloned into an inducible ...
-
bioRxiv - Cell Biology 2019Quote: ... The H2B-mRFP expression construct for human cells was obtained from Addgene (#26001), transfected to 293T cells to produce viruses and infect HeLa Cyclin B1-Venus expressing cells to generate a stable cell line ...
-
bioRxiv - Cancer Biology 2019Quote: ... Human CTNNB1 expression plasmid deposited by Eric Fearon was purchased from Addgene (#16828). CD24 cDNA cloned into the pCDNA3.1 vector and the full-length 3′-UTR of CD24 cloned into pMIR (Ambion ...
-
bioRxiv - Cell Biology 2020Quote: pEGFP-LC3 (human) deposited by Toren Finkel lab was obtained from Addgene (# 24920)(Lee ...
-
bioRxiv - Cancer Biology 2019Quote: ... Human MRTFA was amplified out of the p3xFLAG-MRTFA vector (Addgene plasmid#11978) and tagged with gateway adapters which preserve the N-terminal 3x FLAG tag from the vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... were generated by subcloning the respective human cDNA (from Addgene #100142 and #66350) into the MluI and BamHI sites] of the pLVX-Che-hi3 vector (a gift of Sanford Simon)78 ...
-
bioRxiv - Cell Biology 2021Quote: ... The coding sequences of human myogenin (gift from Matthew Alexander & Louis Kunkel (Addgene plasmid #78341 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human DLK1 ectodomain expression vector was obtained from Addgene (DLK1-bio-His, RRID:Addgene_51876) (Sun et al. ...
-
bioRxiv - Biophysics 2020Quote: ... and a guide RNA/Cas9 plasmid pX330 human 3’ HP1α gRNA (Addgene 127907) with Lipofectamine 2000 according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... WT and inactive human TRPA1 variants were subcloned into CaM/pIRES2-eGFP (Addgene) at the NheI/EcoRI sites to generate a positive fluorescent readout for transfection in singly transfected calcium imaging studies ...
-
bioRxiv - Cancer Biology 2020Quote: ... Overlapping oligonucleotides (Feng Zhang lab human GeCKOv2 CRISPR knockout pooled library; Addgene #1000000048) were annealed to generate sgRNA targeting GFAT1 or NAGK ...
-
bioRxiv - Neuroscience 2022Quote: ... The V5-tagged human GLUT1 construct was a gift from Wolf Frommer (Addgene) 89 ...
-
bioRxiv - Cancer Biology 2022Quote: ... The designed sgRNAs were cloned into human lentiCRISPR v2 vector (Addgene, MA, USA). For lentiviral packaging ...
-
bioRxiv - Biophysics 2019Quote: ... CTD of the largest subunit of human RNA polymerase II (RPB1, Addgene 35175) and EGFP (Addgene 122147 ...
-
bioRxiv - Biochemistry 2020Quote: We used the human SREBP-1c cDNA containing vector pQCXIN (Addgene, USA, 631514) as a template to generate 2x Flag tagged ...
-
bioRxiv - Microbiology 2020Quote: ... HEK293T target cells transfected with 500ng of a human ACE2 expression plasmid (Addgene) were seeded at 2×104 in 100μL DMEM-10% in a white-bottomed 96-well plate (Corning ...
-
bioRxiv - Cancer Biology 2020Quote: The cDNA of human SNAI1 was subcloned from Flag-Snail WT (Addgene 16218) into pWZL-Blast-GFP (Addgene 12269 ...
-
bioRxiv - Immunology 2020Quote: ... a vector containing human IgG3 was purchased from Addgene (pVITRO1-102.1F10-IgG3/λ) and then cloned into a vector for recombinant IgG expression that we previously engineered [59].
-
bioRxiv - Cancer Biology 2020Quote: ... FLAG-tagged human EZHIP was cloned into the pMT-puro vector (Addgene #17923). Transfections were performed with 2 μg plasmid DNA ...
-
bioRxiv - Developmental Biology 2020Quote: ... human MEG3 cDNA was PCR amplified from the pCI-Meg3 (Addgene Plasmid #44727) using NEB Q5 high-fidelity polymerase ...
-
bioRxiv - Cell Biology 2022Quote: ... human KIFC1(125-673) and mouse BICD2(15-595) were obtained from Addgene (plasmids #133242 ...
-
bioRxiv - Bioengineering 2022Quote: ... we utilized the Human Genome-wide CRISPRa-v2 Library (Addgene Pooled Libraries #83978) consisting of 104,540 sgRNAs targeting 18,915 genes (top 5 sgRNAs per gene) ...
-
bioRxiv - Cell Biology 2022Quote: Point mutations were generated on a human fibronectin pMAX vector plasmid (Addgene, #120402) using the Q5 site-directed mutagenesis kit (BioLabs ...
-
bioRxiv - Neuroscience 2022Quote: Human ATG9A was amplified from pMXs-puro-RFP-ATG9A from Addgene (plasmid #60609) and subcloned into the EGFP-N1 vector ...