Labshake search
Citations for Addgene :
501 - 550 of 2026 citations for Human Chemokine C X C Motif Receptor 5 CXCR5 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: The human SAM CRISPRa sgRNA library (Addgene #1000000078) was cloned into the pHW-TRPPC-NS rescue plasmid backbone for PR8 (Fig S2A ...
-
bioRxiv - Biophysics 2023Quote: Human MeCP2 in the pTXB1 plasmid (Addgene #48091) was propagated in E ...
-
bioRxiv - Immunology 2023Quote: A lentiviral construct containing human ACE2 (Addgene 155295) or mScarlet (Addgene 85044 ...
-
bioRxiv - Cancer Biology 2023Quote: ... we used human decipher module 1 library (RRID:Addgene_28289)(Diehl et al ...
-
bioRxiv - Physiology 2023Quote: ... containing human Fis1 gene were purchased from Addgene. The working viral vectors were constructed from these two plasmids by Custom DNA Constructs ...
-
bioRxiv - Biochemistry 2023Quote: Human BIN1-EGFP (isoform 8) (Addgene plasmid #27305) and human dynamin2 C-terminally tagged to mCherry were cloned in pET15b with an N-terminal 6xHis and a C-terminal StrepII tag ...
-
bioRxiv - Neuroscience 2021Quote: ... targeted to mouse PGRN exon 1 (oligos with 5’-cacc gGCTCCCTGGGAGGCATCTGG-3’ and 5’-aaac CCAGATGCCTCCCAGGGAGCc-3’ or 5’-cacc gCGGACCCCGACGCAGGTAGG-3’ and 5’-aaac CCTACCTGCGTCGGGGTCCGc-3’ were ligated to pLenti-CRISPRv2 (Addgene)) or Cas9 only ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK293 cells were co-transfected with plasmids encoding wide-type myc-human TREM2 and GFP-human TDP-43 (residues 216-414, Addgene, 28197) or GFP control by the calcium phosphate precipitation method ...
-
bioRxiv - Genetics 2020Quote: sgRNA sequences targeting human USP15 were selected from the Human Brunello CRISPR knockout pooled library (Doench et al., 2016)(Addgene #73178) and further selected on the basis of high quality score in two additional online tools ...
-
bioRxiv - Cancer Biology 2021Quote: ... we amplified human KEAP1 and LKB1 off of human cDNA and used Gibson assembly to replace GFP in pMCB306 (Addgene #89360) with these sequences ...
-
bioRxiv - Biophysics 2024Quote: Human RING1b (Uniprot ID Q99496) and human BMI1 (Uniprot ID P35226) were cloned into a pFBOH-mhl vector (Addgene plasmid # 62304) cleaved with BseRI using Gibson Assembly® Master Mix (NEB #E2611L ...
-
bioRxiv - Cell Biology 2022Quote: A His-tagged mouse Capping Protein (F-actin-capping protein subunit alpha-1 and F-actin-capping protein subunit beta) plasmid was obtained from Addgene as described above (Plasmid #89950) ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/5 (Addgene #104964), pAAV2/6 (Addgene #110660) ...
-
bioRxiv - Molecular Biology 2023Quote: Constructs for shRNA targeting Primpol (5’- ATTTAGCCGACACCTAATATT) Smarcal1 (5’- CTGATTCAAGAGAAGATTAAA) and Smug1 (5’- AACTATGTGACTCGCTACT) were designed and inserted into pLKO.1neo plasmid (Addgene #13425). Lentiviruses were generated using a standard protocol (Feng and Jasin ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV-DJ-EF1a-Coff/Fon-GCaMP6m (4.5 x e12, Addgene plasmid) was packaged at the HHMI Janelia Research Campus virus facility ...
-
bioRxiv - Neuroscience 2023Quote: ... or mixed with AAV5.hSynap.FLEX.SF-iGluSnFR.A184S (Addgene, titer 1.3 x 1013). For GCaMP expression in the DRG neurons and their axonal terminals within the DCN ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAVrg-hSyn-Cre (≥ 1.8 x 1013 vg/ml, Addgene # 105553) virus was bilaterally infused onto the iCA1 (AP-2.75 ...
-
bioRxiv - Neuroscience 2023Quote: ... The 5-HT1eR and 5-HT1FR PRESTO-Tango constructs were obtained from Addgene. For transfection ...
-
bioRxiv - Immunology 2021Quote: Human SHP-1 wt cDNA was obtained from Addgene. The cDNA of SHP-1 was subcloned into the expression vector pEYFP-N1(Clontech ...
-
bioRxiv - Cell Biology 2022Quote: ... human APC open reading frame purchased from Addgene (#16507), tdmirfp670nano from Max Wilson ...
-
bioRxiv - Biochemistry 2020Quote: ... Human ACE2 plasmid was obtained from Addgene (#1786, (6)) ...
-
bioRxiv - Neuroscience 2020Quote: ... the human ACE2 ORF was PCR amplified from Addgene plasmid 1786 and C-terminally fused with the porcine teschovirus-1-derived P2A cleavage sequence (ATNFSLLKQAGDVEENPGP ...
-
bioRxiv - Systems Biology 2021Quote: ... we used the human CRISPRi v2 library (Addgene #83969) (17) ...
-
bioRxiv - Cell Biology 2020Quote: ... A pMXs retroviral vector encoding human OCT3/4 (RRID:Addgene_17217), human SOX2 (RRID:Addgene_17218) ...
-
bioRxiv - Biophysics 2020Quote: ... human 3’ HP1α-AID-sfGFP 2A PuroR (Addgene 127906) and a guide RNA/Cas9 plasmid pX330 human 3’ HP1α gRNA (Addgene 127907 ...
-
bioRxiv - Microbiology 2021Quote: ... The recombinant plasmid containing human ACE2 gene (Addgene #1786) was transfected into HEK293T cells using Lipofectamine 2000 Transfection Reagent (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2020Quote: ... The human NKCC1 coding sequence was derived from Addgene plasmid # 49077 ...
-
bioRxiv - Cancer Biology 2022Quote: The human CRISPR activation pooled library Set A (Addgene plasmid #92379 was a gift from David Root and John Doench ...
-
bioRxiv - Microbiology 2020Quote: ... the human hACE2 ORF was PCR amplified from Addgene plasmid 1786 and C-terminally fused with the porcine teschovirus-1-derived P2A cleavage sequence (ATNFSLLKQAGDVEENPGP ...
-
bioRxiv - Cancer Biology 2021Quote: Wild-type TP53 from both human (Addgene plasmid #69003) or zebrafish (3 days old embryos cDNA ...
-
bioRxiv - Developmental Biology 2021Quote: Human GeCKO v2 library was obtained from Addgene (#1000000048) and amplified according to the provided instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Human CD63 (Addgene plasmid #62964, gift from Paul Luzio) and mScarlet25 (Addgene plasmid #85042 ...
-
bioRxiv - Molecular Biology 2021Quote: ... human GFP-RBFOX2 (transcript variant 3) (Addgene, plasmid #63086) or empty vector (pcDNA 5 ...
-
bioRxiv - Cell Biology 2022Quote: ... the Bassik Human CRISPR Knockout Library (Addgene, 101926-101934) is separated into 9 sublibraries comprising a total of 225,171 elements and targeting approximately 20,500 genes (10 sgRNAs per target) ...
-
bioRxiv - Neuroscience 2023Quote: ... under the human synapsin promoter were obtained from Addgene. All viruses were stored at -80°C and aliquots were thawed over wet ice immediately prior to injection.
-
bioRxiv - Microbiology 2023Quote: The human “Brunello” CRISPR knockout pooled library (#73179, Addgene) (Doench et al. ...
-
bioRxiv - Neuroscience 2022Quote: Human CRISPRi sgRNA library Dolcetto Set A17 (Addgene #92385) was transformed into electrocompetent Lucigen Endura™ E ...
-
bioRxiv - Neuroscience 2022Quote: The human Dolcetto CRISPR inhibition pooled library (Addgene #92385), and the plasmids pLX_311-KRAB-dCas9 (Addgene #96918) ...
-
bioRxiv - Immunology 2023Quote: The human genome-wide CRISPRa-V2 library (Addgene 1000000091) was co-transfected with packaging plasmids pCAG-VSVG and psPAX2 (Addgene plasmids 35616 and 12260 ...
-
bioRxiv - Immunology 2023Quote: ... The GeCKO V2 human CRISPR knockout library from Addgene was then introduced into Endura Electrocompetent Cells by means of electroporation using a Bio-Rad Gene Pulser ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human STIM1-CFP plasmid (52) was from Addgene (#19755). CAV1-mEGFP plasmid (53 ...
-
bioRxiv - Molecular Biology 2023Quote: The Human GeCKOv2 CRISPR knockout pooled library19 (Addgene 1000000048), which contains 6 sgRNAs for each gene and 2,000 non-targeting control sgRNAs ...
-
Astroglia proliferate upon biogenesis of tunneling nanotubes and clearance of α-synuclein toxicitiesbioRxiv - Cell Biology 2023Quote: The human α-SYN wild-type (Addgene ID #36046) and α-SYN (wt)-141C (Addgene ID #108866 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human LATS1 expression plasmids were obtained from Addgene (41156). Human and murine NLRC5 and CXCL10 promoters were cloned into pGL3 basic luciferase reporter vector (Promega) ...
-
bioRxiv - Cancer Biology 2023Quote: The lentiCRISPR v2 GeCKO Human library (Addgene plasmid #52961) was amplified following Sanjana et al. ...
-
bioRxiv - Zoology 2023Quote: ... or a human TLR4 expression clone (Addgene, cat. #13018). Additionally ...
-
bioRxiv - Neuroscience 2023Quote: ... a human codon optimized FLAG-Cas9 cDNA (Addgene 42230) was modified by C-terminal insertion of an additional nuclear localization signal and a 6-His tag ...
-
bioRxiv - Cancer Biology 2023Quote: A human kinase domain-focused gRNA library (Addgene 117725) [25] was used to assess CRISPR Cas9 screening as a tool in breast cancer PDTO to identify whether novel vulnerabilities could be detected for each PDTO ...
-
bioRxiv - Microbiology 2023Quote: ... human CRISPR Brunello lentiviral pooled libraries (#73179-LV; Addgene) were added to the cell culture at an MOI of 0.25 in the presence of polybrene (Santa Cruz ...
-
bioRxiv - Neuroscience 2023Quote: Full-length recombinant human WT α-syn (Addgene #213498), α-syn 1-95 (Addgene #213499) ...