Labshake search
Citations for Addgene :
801 - 850 of 2026 citations for Human Chemokine C X C Motif Receptor 5 CXCR5 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... AAV2-retro-CMV-EGFP (Suppl. Fig. 8A; Salk Vector Core; 3.7 x 1012; Addgene plasmid #32395); AAV1-EF1a-DIO-hChR2(H134R)-EYFP (Fig ...
-
bioRxiv - Microbiology 2022Quote: ... This fragment was then inserted into the pLenti-mCherry-Mango II x 24 plasmid (Addgene #127587) digested with Nhe I and BamH I ...
-
bioRxiv - Neuroscience 2023Quote: ... a viral vector for the expression of the genetically encoded calcium indicator GCaMP6f (pAAV.Syn.GCaMP6f.WPRE.SV40, Cat. Number #100837-AAV1, titre 1.3 x 1013, Addgene 95) was injected stereotaxically (Kopf ...
-
bioRxiv - Immunology 2021Quote: The SARS-CoV-2 pseudoviral particles expressing COVID-19 spike protein pGBW m4137384: S protein was purchased from Addgene (149543) and the virus particles were produced as describe previously (Hoffmann et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... Plasmid encoding for mitochondria specific protein/ autophagosome specific protein is transfected in HEK293T cells along with packaging vector (pDR8.2; Addgene #8455) and envelope encoding protein (VSVG ...
-
bioRxiv - Cell Biology 2023Quote: ... Ras GTPase-activating protein-binding protein 1 (G3BP1) phage UbiC G3BP1-GFP-GFP was a gift from Jeffrey Chao (Addgene plasmid # 119950 ...
-
bioRxiv - Systems Biology 2021Quote: ... and envelope protein pCMV-VSV-G (Addgene #8454) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and pBAD expressing fluorescent protein variants (Addgene, UK). Primers used in the assembly of the vectors are listed in SI Table 1.
-
bioRxiv - Biophysics 2022Quote: Fluorescent proteins were obtained from Addgene (https://www.addgene.org/) transfected using 0.2 ug plasmid DNA ...
-
bioRxiv - Physiology 2022Quote: ... EGFP-DCTN1 fusion protein (Addgene pEGFP-p150Glued, #36154) or tdTomato-EB3 fusion protein (Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: ... The shRNAs targeting HDAC1 (5′-CTATGGTCTCTACCGAAAA-3′) and HDAC3 (5′-GCATTGATGACCAGAGTTA-3′) were cloned into pLKO.1-TRC lentiviral vector (Addgene, #10878). For generation of lentivirus ...
-
bioRxiv - Cell Biology 2019Quote: ... non-targeting (5’-CCTAAGGTTAAGTCGCCCTCG-3’) and DDRGK1-targeting (5’-GGCTCTGCTAGTCGGCTTTAT-3’) shRNAs were cloned into pLKO.1 puro construct (Addgene #8453) according to protocol described in Addgene (https://www.addgene.org/tools/protocols/plko/?gclid=Cj0KCQiAm5viBRD4ARIsADGUT25ZCGNPeQSFvLqSwvg2tHDkCc9zOZsLdaUffZzNTRYzI_YOlKFVQdUaAqbfEALw_wcB)
-
bioRxiv - Microbiology 2019Quote: ... TAAGATCTGTTTAGTGGTGATGGTGATGATGTTTTCCCTTTTGACCTGCGTG EphA2 sgRNA constructs oligos: 5-AAACGTGTGCGCTACTCGGAGCCTC-3 and 5-CACCGGAAGCGCGGCATGGAGCTCC-3 were annealed and ligated into a lentiGuide-Puro plasmid (Addgene, # 52963). EphA4 sgRNA constructs ...
-
bioRxiv - Microbiology 2019Quote: ... EphA4 sgRNA constructs: oligos 5-AAACCACAGTACATTTTTGGCACAC-3 and 5-CACCGTGTGCCAAAAATGTACTGTG-3 were annealed and ligated into a lentiGuide-Puro plasmid (Addgene, # 52963). Sequencing was performed for all constructs to confirm the correct sequence.
-
bioRxiv - Immunology 2021Quote: ... TPC2(L564P):GCaMP6s and TPC2(L265P/L564P):CaMP6s sequences were amplified (forward primer, 5’-TCCGAATTCAATGGGTTCTCATCATCATCATCATCA-3’, reverse primer, 5’-GATACCGGTTGCAACTTCGCTGTCATCATTTGTACAAAC-3’) and subcloned into mApple N1-vector (Addgene #54567) via EcoRI und AgeI sites.
-
bioRxiv - Neuroscience 2020Quote: ... via the primers 5’ GGAATTCATAGGGCGGCCGGGAA 3’ and 5’ AGCGCTGGCCGGCCGTTTAAAC 3’ and was cloned into plasmid AAV-PGK-Cre (Addgene plasmid # 24593) between the AfeI (NEB ...
-
bioRxiv - Biochemistry 2021Quote: ... shRNA targeting mSARM1 (5’-CCGGCTGGTTTCTTACTCTACGAATCTCGAGATTCGTAGAGTAAGAAACCAGTTTTTG-3’) or the scrambled shRNA (5’-CCGGCCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGGTTTTTG-3’) were inserted to pLKO.1-puro (Addgene, #8453) with EcoRI and AgeI ...
-
bioRxiv - Genomics 2021Quote: ... two guide RNA sequences (gRNA 5’ TTGGGGGGGCTACTGCCAGC 3’ and 5’ CTTGAACGCCACCCTCTAAC 3’) were cloned into pspCas9(BB)-2A-GFP (Addgene; #48138) and pspCas9(BB)-2A-RFP (Addgene ...
-
bioRxiv - Biophysics 2022Quote: Human kinesin-5 (Kif11/Eg5) 5-513 was PCR amplified from mCherry-Kinesin11-N-18 plasmid (gift from Michael Davidson, Addgene # 55067). This fragment was previously shown to form functional dimers [19] ...
-
bioRxiv - Biochemistry 2021Quote: ... two double-stranded oligonucleotides targeting exon 2 of human SGTA (guide #1: 5′-CATGACCAGCTCCGGCACGG-3′ and guide #2: 5′- CAGGAACTGGATGATGGCGT-3′) were ligated into the pSpCas9(BB)-2A-puro vector (Addgene #62988) using BbsI sites ...
-
bioRxiv - Molecular Biology 2021Quote: ... the annealed oligos to target CRY1 (Sense: 5′ CACCGCCTTCAGGGCGGGGTTGTCG 3′; and Antisense: 5′ AAACCGACAACCCCGCCCTGAAGGC 3’) was inserted into BsmBI of LentiCRISPRv2 plasmid (Addgene #: 52961).
-
bioRxiv - Pathology 2019Quote: ... the full length genomic copy with promoter of MoDNM1 was amplified with MoDnm1-F (5’-AATT GAATTC GTTGAGCAGGCCGAGCGAC-3’) and MoDnm1-R (5’-AATT GAATTC CACTGGCATTTGATTACGCAAGG-3’) inserted into pFGL822 (Addgene, 558226) and introduced into the Modnm1Δ strain.
-
bioRxiv - Biophysics 2019Quote: ... The LRRK2 gene was cloned by using the primer sets: 5’-GCGATAACATGGCTAGTGGCAGC-3’ and 5’-GGGGTTATGCTAGTTACTCAACAGATGTTCGTCTC-3’ with pENTR221-LRRK2 (Addgene #39529) as the template ...
-
bioRxiv - Biochemistry 2021Quote: ... guide sequences 5’GGCATTGCCCGTCATGGCCC3’ and 5’GTCTTCACCGAGCTCATTAA3’ were cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (a gift from Feng Zhang; Addgene plasmid # 42230) and co-transfected with a GFP-expressing plasmid into HCT116 cells using Lipofectamine 2000 ...
-
bioRxiv - Cancer Biology 2021Quote: ... two separate NR2F1 guide RNAs (guide 2: 5’-GATCCGCAGGACGACGTGGC-3’ and guide 4: 5’-GGCTGCCGTAGCGCGACGTG-3’) were cloned into pLentiCRISPRv2 (Addgene #52961). A non-targeting (NT ...
-
bioRxiv - Molecular Biology 2021Quote: ... of plasmids expressing sgRNAs (5′- ATTGTGATATCCGATAGTGAT-3′ and 5′-GTTCTGTCAGTGTGAAGAGG-3′) and Cas9 followed by the 2A-Puromycin cassette (pX459, Addgene #62988). 24 h after transfection ...
-
bioRxiv - Cell Biology 2019Quote: ... the Bmal1 coding sequence was cloned from mouse embryonic cDNA (forward primer: 5’ GGCGAATTCGCGGACCAGAGAATGGAC 3’; reverse primer: 5’ GGGCTCGAGCTACAGCGGCCATGGCAA 3’) and subcloned into the pBABE retroviral expression vector (Addgene, 1764). Retroviral vectors were transfected into Phoenix packaging cells ...
-
bioRxiv - Cancer Biology 2022Quote: ... Oligos 5’ CACCGATCACCCTCTTCGTCGCTT 3’ / 5’ AAACAAGCGACGAAGAGGGTGATC 3’ and 5’ CACCGCTTAGGCCGGAGCGAGCCT 3’/ 5’ AAACAGGCTCGCTCCGGCCTAAGC 3’ were annealed and cloned into the px458 cut with BsaI (Addgene #48138). Plasmids were transfected into cell lines using Genejuice transfection reagent (Merck ...
-
bioRxiv - Cancer Biology 2022Quote: ... gRNA sequences targeting Apc (5-CAACTTCTGGTAATGGTC-3) or Trp53 (5-AATGAGGCCTTGGAACTCA-3) were cloned into the Px330 vector (Addgene plasmid #42230). Organoids were removed from Matrigel using Dispase II (Gibco) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... was PCR amplified from genomic DNA using primers (5’ CAGGTCTCAATCCCGATGTAGAACGCGAG 3’) and (5’ CGGTCTCACATATTGTTTCCTTTCTTTATTCACCGG 3’) and was cloned immediately upstream of SpCas9 amplified from plasmid PX165 (Addgene #48137) (62 ...
-
bioRxiv - Cell Biology 2023Quote: ... the primers 5’-AAACCTGGACCCCACCCCCAGATC-3’ and 5’-CACCGATCTGGGGGTGGGGTCCAG-3’ were annealed and cloned in the px458-pSpCas9(BB)-2A-GFP (Addgene, #48138) using the BpiI restriction site to generate a guide RNA ...
-
bioRxiv - Genomics 2023Quote: ... Guide RNAs (FANCC: 5’-GCAAGAGATGGAGAAGTGTA-3’ and MSH2: 5’-GTGCCTTTCAACAACCGGTTG-3’) were cloned into pSpCas9(BB)-2A-GFP (PX458) vector (Addgene#48138). AHH-1 cells were transfected using Lipofectamine 2000 (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2023Quote: ... The SIYx3-GFP insert was generated with the primers: 5’-GGTGTCGTGAGGATCCACCATGGTGTCTATTTACAGGTAC-3’ 5’-CGCCCTCGAGGAATTCTTACTTGTACAGCTCGTCCATGC-3’ and cloned into pLV-EF1a-IRES-Blast (Addgene #85133) linearized with BamHI and EcoRI restriction enzymes (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... mCherry-iLID was amplified using 5’-GGTAGTAGTGGTAGTAGTATGGTGAGCAAGGGCGA-3’ and 5’-TCGAAGCTTGAGCTCGAGATCTTTAAAAGTAATTTTCGTCGTTCGCT-3’.The fragments were inserted into a pEGFP-C1 vector (Addgene 46956) using the AgeI/BglII restriction sites.
-
bioRxiv - Developmental Biology 2024Quote: ... gcgtgtgttcccagatgtat) and PCR donor generated with primers AP677/678 (5’Biotin::taagtgccaaggctgccaggcgtgtgttcccagaaacaccccaggaatcaacc and 5’Biotin::gtttttactcacccgatcgcctttctcaccaatacacttgtcatcgtcatccttg) on plasmid AP635 (Addgene #99485). Genotyping shows scarless insertion in the coding sequence ...
-
bioRxiv - Immunology 2023Quote: Pseudovirus expressing Wuhan-Hu-1 SARS-CoV-2 S protein were produced by co-transfection of plasmids encoding a GFP protein (Addgene, 11619), a lentivirus backbone (VRC5602 ...
-
bioRxiv - Cell Biology 2019Quote: The human kinome ORF library in pDONOR223 was obtained from Addgene (Cambridge, MA, 1000000014) and cloned into a custom pHAGE-CMV-FLAG destination vector using Gateway cloning technology ...
-
bioRxiv - Cell Biology 2020Quote: ... pcDNA3-HA-human OCRL (76) was supplied by Pietro De Camilli (Addgene plasmid #22207). GFP-C1-PLCdelta-PH (53 ...
-
bioRxiv - Genomics 2020Quote: Human GeCKOv2 CRISPR knockout pooled library was a gift from Feng Zhang (Addgene #1000000048) (16) ...
-
bioRxiv - Developmental Biology 2019Quote: ... The pcDNA3-HA-human OCRL plasmid was a gift from Pietro De Camilli (Addgene plasmid # 22207 ...
-
bioRxiv - Neuroscience 2020Quote: ... The Human CRISPR Libraries v.1.0 and v1.1 have been previously described (Addgene, 67989)12,42 ...
-
bioRxiv - Cell Biology 2022Quote: ... The pGEX6P1-human full-length LIC1 plasmid was a gift from Ron Vale (Addgene plasmid # 74597 ...
-
bioRxiv - Biophysics 2022Quote: The gene with codon-optimized human dysferlin cDNA was obtained from Addgene (Plasmid 67878) [47] ...
-
bioRxiv - Neuroscience 2019Quote: ... and VSV-G envelope generated by inserting human Sirt3 plasmid (Purchased from Addgene #13814) into HIV.SIN.cPPT.CMV.eGFP.WPRE (Purchased from U Penn Vector Core ...
-
bioRxiv - Cell Biology 2019Quote: ... Human B-Raf under T7 promoter was a gift from Dustin Maly (Addgene #40775) and was further modified by the insertion of two additional FLAG tags and of an RBS sequence ...
-
bioRxiv - Physiology 2020Quote: ... Human FL-Dhh sequence was obtained after EcoRI digestion of pBS hSHH (Addgene ID13996) and then cloned at the EcoRI site of pCDNA3.1 myc His to generate the pcDNA3-FL-Shh plasmid ...
-
bioRxiv - Genetics 2021Quote: We digested the human STARR-seq screening vector (hSTARR-seq_SCP1 vector_blocking 4, Addgene #99319) with both Thermo SgrDI and BshTI (AgeI ...
-
bioRxiv - Neuroscience 2021Quote: ... The human codon-optimized Cas9 (kindly made available by George Church, Addgene plasmid # 41815) and the sgRNA (encoded by a pFUS-U6 vector ...
-
bioRxiv - Biochemistry 2021Quote: The gene encoding human SLC7A11(I.M.A.G.E. clone IRAUp969G0966D) was cloned into pLexM (Addgene 99844) 53 with an N-terminal Flag tag inserted via PCR ...
-
bioRxiv - Cell Biology 2021Quote: Human SEC24D was cloned from pJK15 plasmid into pAcGFP1-C1 (Addgene, Watertown, MA, USA) to generate a GFP-SEC24D fusion gene ...