Labshake search
Citations for Addgene :
651 - 700 of 1659 citations for Human TGF beta 3 TGFB3 qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... a single guide sequence (primers JBW0001/2) targeting MSH2 exon 6 was cloned into pSpCas9(BB)-2A-GFP (PX458, Addgene #48138) as described24 ...
-
bioRxiv - Neuroscience 2022Quote: pFUGW-NLS-FlpO was created using a PCR reaction for NLS-FlpO with primers AJ20130 - AJ20131 using pAAV hSynapsin FlpO (Addgene #60663), a gift from Massimo Scanzianis (Xue ...
-
bioRxiv - Cancer Biology 2021Quote: ... were amplified using primers containing overhangs with the homology sites for GMAP cloning and inserted into a lentiviral vector (LV 1-5, Addgene, 68411). This lentiviral backbone was a gift from Dr ...
-
bioRxiv - Bioengineering 2022Quote: ... The hU6 promoter fragment was generated by amplifying the U6 promoter with primer set AA-MluI-U6-gib-FW/AA-U6-sg1-scaf-short-RV from the plasmid backbone pSI-359 (Addgene 131131) and the dsRed filler fragment was generated by amplifying a portion of the dsRed gene from CMVp-dsRed2-Triplex-HHRibo-gRNA1-HDVRibo-pA (Addgene 55201 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 35 μl of hot glycerol was cooled to 4°C then 35 μl of the primer mixture and 25 μl of Tn5 (Addgene #112112) was added and mixed and held at 1 hr at RT with gentle pipet mixing every 15 min ...
-
bioRxiv - Cell Biology 2022Quote: ... were amplified using primers containing overhangs with the homology sites for GMAP cloning and inserted into a lentiviral vector (LV 1-5; Addgene, 68411). IL6-EGFP from pmIL-6promoterEGFP (Addgene 112896) ...
-
bioRxiv - Neuroscience 2024Quote: ... that was first PCR amplified using custom primers (see Table 2) from a plasmid containing lexAop2 (lexAop2-myr-4xSNAPf, RRID: Addgene 87638) and then restriction digested using HindIII and PspXI (New England BioLabs ...
-
bioRxiv - Molecular Biology 2024Quote: ... The dual guide backbone1-tRNA cassette was synthesised (Gblock, IDT) and amplified with primers containing the two guideRNA target sites followed by Gibson cloning into pX458 (Addgene #48138). Plasmids were transfected into the KOLF2_C1 hiPSC line with TransIT-LT1 (Mirus Bio ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2018] genomic DNA using RLO336/RLO338 and RLO337/RLO339 primers (Table 2) which introduce sequences homologous to the regions flanking the SacI and HindIII sites of pRG216 (Addgene #64528) [Gnügge and Rudolf 2017] ...
-
bioRxiv - Developmental Biology 2024Quote: ... gcgtgtgttcccagatgtat) and PCR donor generated with primers AP677/678 (5’Biotin::taagtgccaaggctgccaggcgtgtgttcccagaaacaccccaggaatcaacc and 5’Biotin::gtttttactcacccgatcgcctttctcaccaatacacttgtcatcgtcatccttg) on plasmid AP635 (Addgene #99485). Genotyping shows scarless insertion in the coding sequence ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and the sgRNA cassette was amplified by the primers with SpeI and XhoI overhangs using pgRNA plasmid as the template (Addgene 44251). To construct the pBBR1-MCS1-plac-cas9-sgRNA backbone ...
-
bioRxiv - Microbiology 2023Quote: ... with a PCR product containing a T2A-HygR cassette that was amplified using primers 3551/3552 and template lenti MS2-P65-HSF1_Hygro (Addgene Plasmid #61426). The initial control insert shRNA NT control #4 was replaced by digesting pZIP-ZsGreen-T2A-Hyg-shNT4 with NotI and MluI and inserting miR-30-based shRNAs for cFLIP (sh1 ...
-
bioRxiv - Cell Biology 2023Quote: ... 2xP4M-SidM was first amplified using P3 and P4 primers and GFP:P4M-SidM2x (a gift from Prof. Tamas Balla, Addgene plasmid # 51472) as a template and introduced into the vector pHD22 ...
-
bioRxiv - Molecular Biology 2022Quote: ... we first amplified the cassettes including sgRNA using the primer set priEK-35 and priEK-37 from the CRISPRi-V2 library (Addgene #1000000093) using Phusion polymerase (New England Biolab ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Synthetic enhancers were amplified by PCR with primers that included homology to the plasmid vector E1b-GFP-Tol2 (Addgene plasmid #37845)81 and were cloned upstream of the minimal promoter (E1b ...
-
bioRxiv - Plant Biology 2023Quote: A pair of oligos containing the gRNA sequence were used in conjunction with vector-specific primers (Table S1) for PCR amplification of Medicago truncatula U6 promoter and scaffold from the pUC-gRNA plasmid (Addgene #47024) using Q5® High-Fidelity 2X Master Mix (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Labor-associated endogenous gene promoters were cloned into the pGL4.23 backbone either directly from gDNA (using overhang-containing primers) in the case of the Fos promoter (Addgene catalog #188113), or from transitional pJET-1.2 vector backbones containing the cloned promoter ...
-
bioRxiv - Plant Biology 2024Quote: ... ONAC024 and SS1/ ONAC025 were amplified using gene-specific primers (Supplemental Table 1) and cloned in pGADT7-GW/pGADT7-AD (Addgene, USA) through Gateway® cloning technology ...
-
bioRxiv - Neuroscience 2024Quote: ... These sequences were incorporated in primers listed in Table S2 and used to amplify fragments from the pCFD6 vector (Addgene #73915). The final plasmid was assembled using NEBuilder® HiFi DNA Assembly Cloning Kit (NEB) ...
-
bioRxiv - Biochemistry 2024Quote: ... genes were PCR-amplified with the primers listed in Table S1 using the following templates: RFK: pDONR223-RFK (Addgene plasmid #23698) [16] ...
-
bioRxiv - Cell Biology 2020Quote: ... an sgRNA (5’-TTGGCACGCCTCCTCAGGCA-3’) was sub-cloned into PX458 (Addgene, 48138). The C-terminal region of the CENP-E gene was amplified with the following primers ...
-
bioRxiv - Developmental Biology 2021Quote: ... or exon 3 of TET3 and cloned into pX330 vector (Addgene #42230) as previously described 47 ...
-
bioRxiv - Neuroscience 2021Quote: pAAV-CaMKIIa-eGFP (titer ≥ 3×1012 vg/mL, Addgene, catalog # 50469-AAV5) and pAAV5-CaMKII-hChR2(H134R)-eYFP-WPRE (titer ≥ 1×1013 vg/mL ...
-
bioRxiv - Biochemistry 2021Quote: pCDEF3-hTIM-3 was a gift from Lawrence Kane (Addgene plasmid # 49212), and contained the natural variant L119 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 3 µg pBABE-neo largeT antigen cDNA (Addgene, 1780 ref (16))using lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Developmental Biology 2020Quote: ... The injection mix contained: 60 ng/µl Peft-3::Cas9 (Addgene #46168), 15 ng/µl repair template ...
-
bioRxiv - Biochemistry 2020Quote: pHA#851: osm-10p∷Fynempty∷unc-54 3’UTR (Addgene ID: 139208)
-
bioRxiv - Biochemistry 2020Quote: pHA#853: mec-4p∷Fynempty∷unc-54 3’UTR (Addgene ID: 139210)
-
bioRxiv - Biochemistry 2020Quote: pHA#850: osm-10p∷FynY531F∷unc-54 3’UTR (Addgene ID: 139207)
-
bioRxiv - Cancer Biology 2022Quote: ... 3×106 HEK293T cells were transfected with 2.25 µg psPAX2 (Addgene, 12260), 1.5 µg pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... DCX DNA was cloned into the N-Terminal pFLAG 3 vector (Addgene) by restriction digest using NotI and BamHI restriction enzymes ...
-
bioRxiv - Neuroscience 2022Quote: ... for astrocyte Ca2+ detection or AAV9.hSyn.GCaMP6f (3 × 1012 gc/ml, Addgene) for neuronal Ca2+ detection was mixed with the astrocyte-targeted CalEx encoding construct AAV2/5.GfaABC1D-HA-hPMCA2w/b (1.18 × 1013 gc/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... or RB1 (5’-GCTCTGGGTCCTCCTCAGGA-3’) were cloned into the lentiCRISPRv2 (Addgene #52961) plasmid ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The pRPC-oscillator plasmid is based on pZS1-lTlrLLtCL [3] (Addgene #26489) with the dCas9 gene taken from pdCas9-bacteria [18] (Addgene #44249) ...
-
bioRxiv - Immunology 2021Quote: ... EMTP-3×GFP was a gift from William Bement (Addgene plasmid # 26741). Histone 2B-GFP was a gift from Geoff Wahl (Addgene plasmid # 11680) ...
-
bioRxiv - Cell Biology 2022Quote: ptf-Galectin-3 was a gift from Tamotsu Yoshimori (Addgene plasmid # 64149) (Maejima et al. ...
-
bioRxiv - Molecular Biology 2024Quote: ... pCS2-nCas9n-nanos 3’UTR was a gift from Antonio Giraldez (Addgene plasmid # 62542 ...
-
bioRxiv - Neuroscience 2024Quote: ... we bilaterally injected RetroAAV-hSyn-Cre (500nL, Addgene Lot v70508, 3*1013) into the LS ...
-
bioRxiv - Cancer Biology 2024Quote: ... SEPSECS: 5’-AACCGCGAGAGCTTCGCGG-3’ were cloned into lentiCRISPRv2 vector (Addgene, Plasmid #52961) using BsmBI restriction sites ...
-
bioRxiv - Developmental Biology 2024Quote: ... 3 μg of episomal pCXLE-Sox2A61V-2A-Klf4-2A-Myc (Addgene #210017) and 3 μg of pCXWB-EBNA1 (Addgene #37624 ...
-
bioRxiv - Cell Biology 2023Quote: ... an Fmr1 exon 3 DNA oligonucleotide was inserted into pLentiCRISPR (Addgene, 49535) adapted from published methods [12] ...
-
bioRxiv - Cancer Biology 2023Quote: ... and Isoform 3 constructs were cloned into a pMSCV puro backbone (Addgene) and packaged into retrovirus using Phoenix-AMPHO producer cells (ATCC) ...
-
bioRxiv - Genetics 2022Quote: ... 500 ng/ul pBac[3xP3-EGFP;Tc’hsp5’-Gal4Delta-3’UTR] (Addgene #86449), 80 ng/ul Of-v gRNA described above (see “CRISPR/Cas9 mutagenesis of Of-vermilion”) ...
-
bioRxiv - Cell Biology 2023Quote: ... 3) pMXs-IP-EGFP-mATG5 was a gift from Noboru Mizushima (Addgene plasmid #38196 ...
-
bioRxiv - Cancer Biology 2023Quote: PC-3 cells were transfected with Emerin-pEGFP-C1 (Addgene plasmid #61993). Forty-eight hours post-transfection cells were cultured in medium containing G-418 (400Lμg/ml ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV8-hSyn-EGFP (1μL per site, titer ≥ 3 ×1012 vg/mL, Addgene) was injected bilaterally in the dHP ...
-
bioRxiv - Cell Biology 2024Quote: ... co-injection marker pCFJ104 (Pmyo-3-mCherry; Addgene #19328, 5 ng/µL) and marker pCFJ90 (Pmyo-2-mCherry ...
-
bioRxiv - Molecular Biology 2020Quote: dCas9 repressor was PCR-amplified with primers containing SfiI sites from dCas9-KRAB-MeCP2 (a gift from Alejandro Chavez & George Church; Addgene plasmid #110821) (Yeo et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... MDA-MB-231 cell line stably expressing Flag–Rab40b-4A was created by cloning Rab40b-4A (primers purchased from IDT, Coralville, IA) into lentiviral pCS2-FLAG vector obtained from Addgene (Cambridge, MA). Cell lines were routinely tested for mycoplasma ...
-
bioRxiv - Cancer Biology 2020Quote: ... and amplified ZBP1 cDNA using forward: GGGAATTCATGGCCCAGGCTCCTGCT and reverse: TAGCGGCCGCCTAAATCCCACCTCCCCA primers from pEGFPN.1 vector cloned into LeGO-iG2-IRES-EGFP vector (Addgene plasmid #27341) between EcoRI and NotI sites followed by 5x strep-tag II (TGGAGCCATCCGCAGTTTGAAAAA ...