Labshake search
Citations for Addgene :
701 - 750 of 1659 citations for Human TGF beta 3 TGFB3 qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: Riboprobes for in situ hybridization were synthesized using the oligonucleotide primers listed in Supplementary Table 4 to clone the DNA fragment of interest into vector pJC53.2 (Addgene Plasmid ID: 26536), followed by riboprobe synthesis previously described 80.
-
bioRxiv - Developmental Biology 2023Quote: Gene fragments were amplified from cDNA using oligonucleotide primers listed in Table S3 and cloned into the vector pJC53.2 (Addgene Plasmid ID: 26536) (Collins et al. ...
-
bioRxiv - Biochemistry 2023Quote: ... The individual ORFs were then amplified by PCR using primers ZJ6-ZJ10 (Table S2) and cloned individually into a pLEW100v5 vector (pLEW100v5 was a gift from George Cross; Addgene plasmid # 24011) using Gibson assembly ...
-
bioRxiv - Cell Biology 2023Quote: ... with N-terminal HA tag added into primers followed by insertion into NotI/EcoRI-linearized pGCGFP-G418 (a gift from Andrew Pierce, Addgene plasmid #31264) using In-Fusion HD (Takara Bio) ...
-
bioRxiv - Bioengineering 2024Quote: ... with primers BW-NH-710 and BW-NH-711 while pTol2Dest was constructed by amplification of pT2/HE (Addgene Plasmid ID: 26557) with BW-NH-792 and BW-NH-793 ...
-
bioRxiv - Molecular Biology 2024Quote: ... mCherry was PCR amplified from plasmid DNA with the primers GGGGACAACTTTTCTATACAAAGTTGACATGGTCTCAAAGGGTGAAGAAG and GGGGACAACTTTATTATACAAAGTTGTTTACTTATACAATTCATCCATG and cloned into pDONR 221 P4r-P3r (Addgene plasmid #121527). The miR-58 hairpin sequence and 100 bp upstream and 1000 bp downstream was amplified from wild type genomic DNA and cloned into pDONR 221 P3-P2 ...
-
bioRxiv - Bioengineering 2024Quote: ... mRFP was amplified from pDEST-12.5’RFP 14 by PCR using primers 7 and 8 listed in Supplementary Table 1 and cloned into the NheI-KpnI site of pEGFP-C2 (Addgene, #6083-1) using the In-Fusion® HD Cloning Kit (Takara Bio USA) ...
-
bioRxiv - Biochemistry 2024Quote: ... HDR repair templates were produced by PCR with target-specific primers containing the homology arms and the plasmid pMaCTag-P05 (Addgene plasmid 120016)89 In addition to the homology arms and the eGFP sequence ...
-
bioRxiv - Evolutionary Biology 2024Quote: Gene fragments for preparing dsRNA were amplified from cDNA using oligonucleotide primers listed in Table S2 and cloned into the vector pJC53.2 (Addgene Plasmid ID: 26536), followed by in vitro transcription as previously described55 ...
-
bioRxiv - Cell Biology 2020Quote: ... pcDNA3-HA-human OCRL (76) was supplied by Pietro De Camilli (Addgene plasmid #22207). GFP-C1-PLCdelta-PH (53 ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNAs of the human proteins were cloned into pTT5 based expression vectors (Addgene #52355). The constructs were tagged with Twin-Strep-tag (SII ...
-
bioRxiv - Genomics 2020Quote: Human GeCKOv2 CRISPR knockout pooled library was a gift from Feng Zhang (Addgene #1000000048) (16) ...
-
bioRxiv - Neuroscience 2020Quote: ... The Human CRISPR Libraries v.1.0 and v1.1 have been previously described (Addgene, 67989)12,42 ...
-
bioRxiv - Cell Biology 2022Quote: ... The pGEX6P1-human full-length LIC1 plasmid was a gift from Ron Vale (Addgene plasmid # 74597 ...
-
bioRxiv - Biophysics 2022Quote: The gene with codon-optimized human dysferlin cDNA was obtained from Addgene (Plasmid 67878) [47] ...
-
bioRxiv - Physiology 2020Quote: ... Human FL-Dhh sequence was obtained after EcoRI digestion of pBS hSHH (Addgene ID13996) and then cloned at the EcoRI site of pCDNA3.1 myc His to generate the pcDNA3-FL-Shh plasmid ...
-
bioRxiv - Genetics 2021Quote: We digested the human STARR-seq screening vector (hSTARR-seq_SCP1 vector_blocking 4, Addgene #99319) with both Thermo SgrDI and BshTI (AgeI ...
-
bioRxiv - Neuroscience 2021Quote: ... The human codon-optimized Cas9 (kindly made available by George Church, Addgene plasmid # 41815) and the sgRNA (encoded by a pFUS-U6 vector ...
-
bioRxiv - Biochemistry 2021Quote: The gene encoding human SLC7A11(I.M.A.G.E. clone IRAUp969G0966D) was cloned into pLexM (Addgene 99844) 53 with an N-terminal Flag tag inserted via PCR ...
-
bioRxiv - Cell Biology 2021Quote: Human SEC24D was cloned from pJK15 plasmid into pAcGFP1-C1 (Addgene, Watertown, MA, USA) to generate a GFP-SEC24D fusion gene ...
-
bioRxiv - Immunology 2021Quote: ... human embryonic kidney 293T/17 cells were transfected with pcDNA3.1(-)hACE2 (Addgene plasmid #1786). Transfection was performed in 293T/17 cells using the genejuice (Novagen ...
-
bioRxiv - Molecular Biology 2022Quote: ... shRNA to human raptor (plasmid#1857) and rictor (plasmid#1853) were purchased from Addgene. The preparation of shRNA infected HEK293 cells have been described previously (28).
-
bioRxiv - Biochemistry 2022Quote: Human PARP6 (Uniprot #Q2NL67-1) was cloned into a modified pFASTBac1 vector (Addgene #30116) with N-terminal 6X His-maltose binding protein (MBP ...
-
bioRxiv - Immunology 2022Quote: ... An amino-terminal 3xFlag epitope tagged human GLUT3 was generated by PCR (Addgene #72877) (Supplementary Table 1) ...
-
bioRxiv - Immunology 2022Quote: Class-switched VRC07 constructs were generated from human isotype backbone plasmids obtained from Addgene. The different human heavy chain constant regions were PCR amplified from the Addgene plasmids and inserted into the previously described AAV transfer vector 11 encoding the VRC07 heavy chain variable region and VRC07 kappa light chain ...
-
bioRxiv - Molecular Biology 2022Quote: The GeCKOv2 human CRISPR knockout pooled library (a gift from Feng Zhang, Addgene #1000000048) was used as described (19 ...
-
bioRxiv - Physiology 2024Quote: HEK 293T were transfected with a human TLR3 plasmid or an empty vector (Addgene). Briefly ...
-
bioRxiv - Genetics 2023Quote: Plasmid mutagenesis was performed on pKS070 - pCAGGS-3XFLAG-(human) CTCF-eGFP (Addgene Plasmid #156448) for CTCF and mEmerald-RAD21-N-18 (Addgene Plasmid #54248 ...
-
bioRxiv - Immunology 2023Quote: ... The amplicons were cloned into human IGHG1 or IGKC or IGLC expression vectors (Addgene number 80795 ...
-
bioRxiv - Cancer Biology 2023Quote: Cas9-expressing DND-41 cells were transduced with Human GeCKOv2 library (Addgene 1000000048, 1000000049) at MOI~0.3 and selected with 1μg/ml of puromycin for 6 days ...
-
bioRxiv - Immunology 2023Quote: ... The CRISPR library vectors (Human CRISPR Metabolic Gene Knockout Library; Addgene, Pooled Library #110066) 12 or the single sgRNA vectors ...
-
bioRxiv - Biochemistry 2023Quote: Plasmids containing human BRCA1 cDNA were a gift from Junjie Chen (Addgene, Plasmid #99394). We cloned the BRCT and RING variant library by designing primers (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2023Quote: The human ASH2L sequence was introduced to the lentiviral vector pLEX305-NdTAG (Addgene#91797) using a Gateway LR reaction (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: ... plasmid containing human codon-optimized Streptococcus pyogenes Cas9 protein and Stk3 (Mst2, Addgene #75975) gRNA was used to dually target Mst1 and Mst2 ...
-
bioRxiv - Cell Biology 2023Quote: The genome-wide human SAM sgRNA library (kind gift from Feng Zhang, Addgene #1000000057) was amplified as previously described (Joung et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... HeLa cells were transfected with 1.5 µg of untagged human Parkin (RRID: Addgene 187897) using Lipofectamine 2000 for 18-24 hrs prior to treatment.
-
bioRxiv - Biophysics 2024Quote: ... A plasmid encoding aa 1-261 of human utrophin (PaGFP-UtrCH, Addgene plasmid #26738) was obtained as a gift from Dr ...
-
bioRxiv - Molecular Biology 2024Quote: The Zαβ domain of human ZBP1 was cloned into the pLIX403_Capture1_APOBEC vector (Addgene #183951) utilizing the gateway cloning method ...
-
bioRxiv - Molecular Biology 2024Quote: ... The Human Ku70 gene was incorporated into the Lenti-iCas9-neo plasmid (Addgene #85400) through a two-step cloning process ...
-
bioRxiv - Genetics 2024Quote: ... Human TLK2 pDONR223 was a gift from William Hahn & David Root (Addgene: Plasmid #23629). Human LC8 expression vectors and its mutants were described previously (42) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... human CAV1 (Caveolin-1) was amplified from plasmid mCherry-Caveolin-C10 [bought from Addgene, catalog number #55008] ...
-
bioRxiv - Neuroscience 2024Quote: ... human TDP-43M337V has subcloned into the pLenti CMV Puro DEST (W118-1, Addgene) plasmid as previously described (Zhang et al ...
-
bioRxiv - Cancer Biology 2024Quote: The all-in-one version of the Human CRISPR knockout Pooled Library (Addgene #73179) was applied for in vitro genome-wide loss-function screen in PaTu-8988t cells23 ...
-
bioRxiv - Neuroscience 2024Quote: ... An adeno-associated virus (AAV) solution expressing jGCaMP7s under the human synapsin promoter (Addgene catalog number 104487-AAV1 ...
-
bioRxiv - Bioengineering 2024Quote: ... human ADAR2DD E488Q (referred to as ADAR2DD in this article) from pC0039 (Addgene #133849)6 ...
-
bioRxiv - Cell Biology 2024Quote: ... we inserted human LC3/GBRP cDNA in a pGEX-4T1 vector (RRID:Addgene_223726; RRID:Addgene_216836; RRID:Addgene_223727 ...
-
bioRxiv - Neuroscience 2022Quote: ... to enable downstream experiments with GFP based reporters together with this line) was amplified from pJFRC206 (with primers smGFP::v5_hifi_F/R from Addgene #63168, (Nern et al., 2015)) ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNAs coding for eIF4A1 and eIF4A1DQAD were PCR-amplified using primers TS64/TS65 and cloned into mTurquoise-C1 and mCitrine-C1 vectors (Addgene #54842 and #54587) using HindIII and BamHI restriction sites ...
-
bioRxiv - Bioengineering 2024Quote: Primers (Table S1) were used to amplify a ∼500 bp region of β-catenin and TA-cloned into pJC53.2 (Addgene Plasmid ID: 26536) (Collins et al. ...
-
bioRxiv - Cancer Biology 2024Quote: ... gRNAs for the constitutive Cas9 backbone were cloned using annealed primers into BsmBI-linearized lentiGuide-Puro (a gift from Feng Zhang; Addgene catalog no. 52963). gRNAs for iCas9 were cloned into pLX-sgRNA (a gift from Eric Lander and David Sabatini ...