Labshake search
Citations for Addgene :
601 - 650 of 2285 citations for Rat Carboxypeptidase A3 Mast Cell CPA3 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... cells were transfected with plasmids phCMV-10A1 (Addgene #15805), pBS- CMV-gagpol (Addgene #35614 ...
-
bioRxiv - Bioengineering 2019Quote: ... coli cells using the plasmid pRK793 (Addgene, Plasmid # 8827)55 ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were transfected with WT RNase H1 (Addgene, 111906), the D210N mutant (Addgene ...
-
bioRxiv - Genomics 2020Quote: ... K562 cells were transduced with lentiCas9-Blast (Addgene 52962) at a multiplicity of infection (MOI ...
-
bioRxiv - Neuroscience 2021Quote: ... which is general to mammalian cells (AAV1.CAG.Flex.GCaMP6f.WPRE.SV40, Addgene), at DIV 3 ...
-
Interleukin 4 controls the role of macrophages in pulmonary metastatic tumor cell seeding and growthbioRxiv - Cancer Biology 2021Quote: ... The fluorescent E0771-LG cell line expressing Clover (Addgene) [57] used in intravital experiments was established by standard transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293T cells were transfected with pMD2.G (Addgene #12259) and psPAX2 (Addgene #12260 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and AdEasier-1 cells (#16399) were purchased from Addgene. Full length Rela gene was inserted into pShuttle-CMV with SalI and NotI to obtain pShuttle-CMV-Rela ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were infected with pACAGW-ChR2-Venus-AAV9 (Addgene). 0.5 ul were added to 500 ul differentiation medium ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were transfected with 4.3 μg psPAX2 (Addgene; 12260), 0.43 μg pCMV-VSV-G (Addgene ...
-
bioRxiv - Microbiology 2023Quote: 293T cells were transfected with pCMV-VSV-G (Addgene) expressing VSV-G or pEF4/HisA (Thermo ...
-
bioRxiv - Bioengineering 2022Quote: ... cells were transfected with lifeact–GFP (Addgene plasmid 15238) using Lipofectamine 3000 transfection kit (Invitrogen ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were transfected with the PX458 plasmid (Addgene 48138) containing the guide sequence (CTTGGTATCGAAGCACAAGC or ACTTTGCAGCCGTCATCGGG ...
-
bioRxiv - Biochemistry 2023Quote: ... HEK293T cells were transfected with pMD2.G (Addgene #12259), psPAX2 (Addgene #12260) ...
-
bioRxiv - Molecular Biology 2023Quote: Transfection of HEK293T cells with pHis-Ubiquitin (Addgene, 31815) was performed by the calcium phosphate-DNA precipitation method 66 ...
-
bioRxiv - Immunology 2024Quote: ... Cells were transfected with 0.25 pRSV-Rev (Addgene, 12253), 0.53 µg pMDLg/pRRE (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: ... A549 cells were transfected with px459-Cas9 plasmid (Addgene), carrying sgRNA for YTHDC1 “ATTCTTATAAGGTTCTCTGG” ...
-
bioRxiv - Cell Biology 2022Quote: ... Control cells were generated using pLenti.Cas9-blast (Addgene, #52962) and the non-targeting control gRNA (Addgene ...
-
bioRxiv - Microbiology 2022Quote: HEK293T cells were transfected with pVSV-G (Addgene #138479), psPAX2 (Addgene #12260) ...
-
bioRxiv - Cancer Biology 2023Quote: ... cell cycle reporter (pBOB-EF1-FastFUCCI-Puro, Addgene #86849), LV-YFP (Addgene #26000) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cell lines were transduced with lentiCas9-Blast13 (Addgene, #52962) and selected with 20 µg/ml blasticidin to generate stable CAS9-expressing cell lines ...
-
bioRxiv - Cancer Biology 2023Quote: ... or the cell cycle marker PIP-FUCCI (Addgene #118616). Transduced cells were selected by FACS sorting.
-
bioRxiv - Immunology 2023Quote: ... Cells were transfected with 0.25 pRSV-Rev (Addgene, 12253), 0.53 µg pMDLg/pRRE (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... HEK293T cells were transiently transfected with psPAX2 (Addgene #12260), PMD2.G (Addgene #12259 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were transfected with pCas9-GFP (Addgene plasmid #44719), pBR322-U6-hPAX3-gRNA-S1 containing sgRNA CCGGCCAGCGTGGTCATCCT and repair template p15A-cm-hPAX3-Venus-neo-1kb containing a Venus-neo cassette with 1 kb hPAX3 homology arms ...
-
bioRxiv - Systems Biology 2023Quote: ... pSLIK 3xFLAG-Luciferase zeo (for B2B1 cells; Addgene #136533) or pSLIK 3xFLAG-LacZ neo (for TM15c6 cells ...
-
bioRxiv - Genetics 2023Quote: ... by co-transfecting cells with TALEN-L (Addgene #35431), TALEN-R (Addgene #35432 ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293T cells were co-transfected with pMDL (Addgene #12251), pREV (Addgene #12253) ...
-
bioRxiv - Cancer Biology 2023Quote: ... U-937 cells were transfected with pCDM8 hCD8121 (Addgene) using the Amaxa Nucleofactor II ...
-
bioRxiv - Cell Biology 2024Quote: HEK293T cells were co-transfected with psPAX2 (Addgene #12260), VSV.G (Addgene #14888) ...
-
bioRxiv - Cancer Biology 2024Quote: shMAFG cells were generated using pLKO.1 (Addgene; 10878) cloned with shRNA sequences (Supplementary Table ...
-
bioRxiv - Immunology 2024Quote: ... cells were co-transfected with pcDNA-mGATA3 (#1332, Addgene) and MSCV-mGfi1-IRES-GFP expression plasmids ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were transiently transfect with BFP-KDEL (Addgene, 49150) and imaged 48 hr later ...
-
bioRxiv - Molecular Biology 2024Quote: ... HEK-293T cells were transduced with LentiCRISPR_V2 vectors (Addgene plasmid 52961 ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were transfected with pEGFP-H1.1 plasmid (Addgene, 32894) using Fugene 6 transfection reagent (Promega ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... were generated using three plasmids to ensure a single round of infectivity: a pseudotyping plasmid for transient expression of the VSV-G envelope protein (pMD2.G, Addgene plasmid #12259, gift from Didier Trono), a plasmid for transient expression of the viral gag/pol ...
-
bioRxiv - Molecular Biology 2023Quote: The MCS of pBAD24 (Guzman et al., 1995) was exchanged for the red fluorescent protein (RFP) cassette from pPGC-C (Addgene plasmid # 174580,(Bentham et al., 2021)) flanked by BsaI restriction sites ...
-
bioRxiv - Neuroscience 2024Quote: ... a 448 bp human synapsin-1 promoter element driving the neuronal specific expression of 4) the fluorescent protein mTagBFP2 (Addgene plasmid #191566 pLKO.1-TRC mTagBFP2) fused to the plasma membrane targeting sequence CAAX2 (Addgene plasmid #162247 ...
-
bioRxiv - Biochemistry 2022Quote: ... The construct was packaged into lentivirus using HEK293T cells and delivered into target cells together with pLenti CMV rtTA3 Hygro (w785-1) (a gift from Eric Campeau Addgene plasmid no. 26730) for tetracycline inducible expression ...
-
bioRxiv - Microbiology 2023Quote: ... we transfected HEK 293T cells with a combination of a donor plasmid (p-GFP: MAP1LC3B-mEGFP gifted from Allen Institute for Cell Science - Addgene Ref 101783), a purified PCR product coding for the gRNA-tracrLC3B and a plasmid coding for Streptococcus pyogenes Cas9 (pCas9 ...
-
bioRxiv - Immunology 2022Quote: ... target cells were derived by transfection with plasmids designed to express the SARS-CoV-2 D614 Spike protein with a c-terminus flag tag (kindly provided by Dr. Farzan, Addgene plasmid no. 156420 (Zhang et al., 2020)) ...
-
bioRxiv - Genetics 2023Quote: ... To generate vectors for the protein stability assay DNMT3B and mutant sequences were cloned into pLenti-DsRed-IRES-EGFP (Addgene plasmid 92194, a gift from Huda Zoghbi).
-
bioRxiv - Cancer Biology 2021Quote: ... HEK293T cells were transfected with 2.25 μg psPAX2 (Addgene, 12260), 1.5 pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2022Quote: ... confined cells transfected with the Kras-Src FRET biosensor (Addgene plasmid no ...
-
bioRxiv - Immunology 2022Quote: ... Cells were transfected with 0.25 μg pRSV-Rev (Addgene, #12253), 0.53 μg pMDLg/pRRE (Addgene ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were transiently transfected with pRK5-myc-Rac1-Q61L (Addgene plasmid # 12983 ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were infected with AAV9-hSyn-GCaMP6f (Addgene #100837-AAV9) at day in vitro 3 (DIV3 ...
-
bioRxiv - Neuroscience 2019Quote: BV2 cells were infected with control lentivirus (pLenti-CRISPR2, Addgene) or lentivirus expressing Cas9 and guide RNA (sequence 5’-GCTCCCTGGGAGGCATCTGG-3’ ...
-
bioRxiv - Bioengineering 2021Quote: ... cells were infected with AAV9-hSyn-GCaMP6f (Addgene #100837-AAV9) at day 3 in vitro (DIV3 ...
-
bioRxiv - Neuroscience 2020Quote: Cells were transfected with 4XCLEAR-Luciferase reporter construct (Addgene #66800)(11 ...