Labshake search
Citations for Addgene :
601 - 650 of 1452 citations for Human Gap Junction Alpha 8 Protein CX50 GJA8 ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Individual gRNAs (Table S2) against murine and human SMARCA4 were cloned into pLentivectorCRISPR v2 (52961, Addgene). Non-target control (NTC ...
-
bioRxiv - Neuroscience 2023Quote: ... pcDNA3.1 Dynamin 1 (human, p880) was a gift from Sandra Schmid and was obtained from Addgene (Addgene plasmid #34682 ...
-
bioRxiv - Neuroscience 2023Quote: ... The human CD68 promoter and enhancer (hCD68, ∼800 bp) was subcloned from pcDNA3-hCD68prm (Addgene #34837). The mouse F4/80 promoter (mF4/80 ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293T cells were transfected with plasmid pLXSN16E6E7 encoding the human papilloma virus HPVE6E7 gene (Addgene #52394) as described [18] ...
-
bioRxiv - Cell Biology 2023Quote: ... from human cDNA and cloned into the LeGO-iG2 (kind gift from Boris Fehse, Addgene #27341). YIPF5 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Human FUS (residues 1-214) was amplified by PCR using pHR-FUSN-mCh-Cry2WT (Addgene #101223). The IDRs fragments were fused with TPPPCORE domain(aa.45-166 ...
-
bioRxiv - Cell Biology 2023Quote: ... human ATAD1 was amplified from HEK293T cDNA and cloned into the pKH3 vector (Addgene plasmid #12555). The ATAD1 Walker B mutation (ATAD1E193Q ...
-
bioRxiv - Neuroscience 2024Quote: ... human TDP-43 was subcloned out of a wtTDP-43tdTOMATOHA (gift from Zoushang Xu, Addgene # 28205) via XhoI and Kpn1 double digest and inserted into a pEGFP-N3 (Clontech ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were transduced with the Human CRISPR Knockout Pooled Library16 (Brunello, lentiCRISPR v2, Addgene 73179-LV) at ∼MOI 0.3 with 8 µg/ml polybrene ...
-
bioRxiv - Cell Biology 2024Quote: The eGFP-CCDC32(FL, human) fragment in a pEGFP-C1 vector was purchased from Addgene (#110505) and then mutated to be siRNA resistant ...
-
bioRxiv - Immunology 2024Quote: Human Brunello CRISPR knockout pooled library was provided by the CRISPR Screen LabTech platform (Addgene #73178).
-
bioRxiv - Cancer Biology 2024Quote: pX459-TP53 vector was generated by cloning sgRNA targeting human TP53 into the pX459 (Addgene #62988). TP53-targeted guide RNA was designed using the designing tool at https://chopchop.cbu.uib.no/ ...
-
bioRxiv - Cell Biology 2024Quote: ... cDNA for human β1-integrin was obtained by PCR using a template plasmid from Addgene (#69804), the sequence was modified to introduce BamHI and NotI restriction sites ...
-
bioRxiv - Cell Biology 2024Quote: Full-length human CEP152 with gRNA resistance (5’-CAGAACAGTTAGAAATGAGT-3’) in pAID 1.1C-T2A-Bsr (Addgene) and CEP152D43/44A in pEGFP-C1 were synthesized by GenScript ...
-
bioRxiv - Cancer Biology 2024Quote: ... To generate MIG-IDH2R140Q the human IDH2R140Q was cloned into MSCV-IRES-GFP (Addgene plasmid #20672). Retroviral generation and transduction of murine foetal liver cells was performed as previously described4.
-
bioRxiv - Biochemistry 2024Quote: ... and human Calmodulin were PCR amplified and subcloned into a p3xFLAG-eYFP-CMV-7.1 vector (Addgene) at the NotI/BamHI sites using In-Fusion EcoDry cloning (Takara ...
-
bioRxiv - Cancer Biology 2024Quote: ... sgRNA sequences were adapted from the human CRISPR metabolic gene knockout library (Addgene pooled library #110066)5 and included genes from the Metabolic Atlas (Human-GEM v1.3.0) ...
-
bioRxiv - Neuroscience 2020Quote: 8 weeks old Mrap2fl/fl Mc4regfp females (n=4) were injected unilaterally with pAAV-Ef1a-mCherry-IRES-CRE (Addgene, catalog #55632-AAV8).
-
bioRxiv - Genetics 2020Quote: ... Male mice at ages 8-12 weeks were Jugular vein injected with 1011 particles of AAV expressing either Cre recombinase (Addgene 107787-AAV8) or GFP (Addgene 105535-AAV8 ...
-
bioRxiv - Developmental Biology 2023Quote: To measure mitophagy in HUVEC were seeded in 6-well plates (8 x 105 cells/well) and transfected with 5ug/well of pCHAC-mt-mkeima plasmids (Addgene plasmids #72342) at a ratio of 1:1.5 plasmids ...
-
bioRxiv - Biophysics 2023Quote: ... a pQE-30/pcl-ts ind+ plasmid containing a His6-small ubiquitin-like modifier (SUMO) SARS-CoV-2 nsp12 and untagged nsp7 and 8 (Addgene no. 160540) was transformed into Escherichia coli BL21 cells (Agilent) ...
-
bioRxiv - Cell Biology 2024Quote: ... Rab7a with a point mutation at residue 8 from leucine to alanine (L8A) was cloned into pEmerald-C1 (Addgene#54734, Davidson Lab) at XhoI-BamHI sites by Genscript ...
-
bioRxiv - Bioengineering 2024Quote: ... mRFP was amplified from pDEST-12.5’RFP 14 by PCR using primers 7 and 8 listed in Supplementary Table 1 and cloned into the NheI-KpnI site of pEGFP-C2 (Addgene, #6083-1) using the In-Fusion® HD Cloning Kit (Takara Bio USA) ...
-
bioRxiv - Neuroscience 2021Quote: stGtACR2: 300 nL 1:10 AAV2/8-hSyn1-SIO-stGtACR2-FusionRed (working concentration 4.7*1011 gc/mL, Addgene/Janelia Viral Core, Ashburn, VA)
-
bioRxiv - Synthetic Biology 2023Quote: ... was cloned by generating PCR fragments from the pTetQCas-8+IS186 and the pTnsABC construct (gift from Sheng Yang (Addgene plasmid # 170636; & #1306331)) using the GeneArt™ Gibson Assembly HiFi Master Mix (InvitrogenTM) ...
-
bioRxiv - Cancer Biology 2021Quote: ... H4 human GBM cells were infected with the whole-genome knockout Brunello library (Addgene, Cambridge, MA, USA), which included ∼19,000 genes with 4 sgRNAs per gene and 10,000 sgRNA non-targeting controls ...
-
bioRxiv - Cell Biology 2020Quote: ... pGEX6P1-human LIC1 C-terminal half (GST-LIC 389-523) was a gift from Ron Vale (Addgene plasmid #74599 ...
-
bioRxiv - Molecular Biology 2020Quote: ... which encodes the human codon-optimized Streptococcus pyogenes Cas9D10A nickase (hSpCas9D10A; a gift from Peter Duchek) (Addgene plasmid ...
-
bioRxiv - Immunology 2021Quote: ... the human CRISPR 2-plasmid activation pooled library (SAM) was a gift from Feng Zhang (Addgene #1000000078) and used for CRISPR activation screening ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human codon-optimized Streptococcus pyogenes wild type Cas9 (Cas9-2A-GFP) was obtained from Addgene (Cambridge, MA). Chimeric guide RNA expression cassettes with different sgRNAs (sgRNA1 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The WT human α4 and β1 subunits were subcloned into the pUNIV vector (Addgene, Cambridge, MA, USA) and the human δ-subunit into the pcDNA5/FRT vector (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... The sgRNA against human TSC2 gene 60 was subcloned into the lentiCRISPR v2 lentiviral vector (Addgene #52961). For lentiviral transduction ...
-
bioRxiv - Cancer Biology 2021Quote: ... and pCMV-VSV-G/pCMV-dR8.2 for human cell lines (Addgene plasmid #8454; http://n2t.net/addgene:8454; RRID:Addgene_8454 and Addgene plasmid #8455 ...
-
bioRxiv - Biochemistry 2022Quote: Human Drp1 (Uniprot ID: O00429-4) with a C-terminal StrepII tag in pET15b (Addgene plasmid #174428) was expressed in BL21(DE3 ...
-
bioRxiv - Neuroscience 2021Quote: ... under the control of the human synapsin-1 gene promoter (AAV-GFP/Cre, 105540-AAV1, pENN.AAV1.hSyn.HI.eGFP-Cre.WPRE.SV40, Addgene, Massachusetts, USA) or with AAV expressing only GFP (AAV-GFP ...
-
bioRxiv - Neuroscience 2021Quote: The immortalized human Schwann iHSC-1λ were infected with lentivirus derived from pLentiCRISPRv2 puro (Addgene, Cat#78852) expressing Cas9 and either a scrambled gRNA or one directed against the human NF1 gene designed to cleave between amino acids 157 and 158 in Exon 4 ...
-
bioRxiv - Neuroscience 2022Quote: ... Mammalian cells were transfected with either the empty vector (pAAV) or human WT aSyn pAAV vector (Addgene plasmid # 36055 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human Brunello CRISPR knockout pooled library was a gift from David Root and John Doench (Addgene #73178). The library was transformed into electrocompetent Lucigen Endura™ Escherichia coli (Lucigen ...
-
bioRxiv - Cell Biology 2021Quote: ... plasmid encoding a mCherry-labeled dominant negative mutant version of human Rab5A was from Addgene (Cat# 35139). GFP-hRab5B.dn3 (#1008 ...
-
bioRxiv - Bioengineering 2020Quote: ... we used the human codon optimized Cas9 from lentiCRISPR v2 plasmid (Addgene 52961, Sanjana et al., 2014) as background for xCas9 and Cas9-NG mutations ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... human CaV3.3 (a1Ic-HE3-pcDNA3 also from Dr E. Perez-Reyes, Addgene #45810 (Gomora et al. 2002) in combination with green fluorescent protein.
-
bioRxiv - Cell Biology 2020Quote: Specific shRNA1 and shRNA2 targeting human ARID1A were cloned into the pLKO.1-TRC-puro vector (Addgene), separately ...
-
bioRxiv - Cell Biology 2020Quote: Human Rab21 (aa 16-225) constructs were cloned into a Gateway destination vector pgLAP1 (Addgene plasmid #19702) to express Rab21 with an N-terminal GFP followed by a TEV cleavage site and an S-Tag in mammalian cells ...
-
bioRxiv - Biochemistry 2021Quote: Human GeCKOv2 CRISPR knockout pooled library (Pooled Library #1000000048),pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene plasmid # 42230), and lentiCRISPR v2 (Addgene plasmid # 52961 ...
-
bioRxiv - Cancer Biology 2021Quote: ... CRISPR-cas9-based guide RNA (gRNA) targeting human EED (GATCATAACCAACCATTGTT) was cloned in LentiCRISPR v2 (Addgene 52961), which was mixed with psPAX2 and pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: ... H4 human GBM cells were infected with the whole-genome knockout Brunello library (Addgene, Cambridge, MA, USA), which covered ~19,000 genes with 4 sgRNAs per gene along with 10,000 sgRNA non-targeting controls ...
-
bioRxiv - Microbiology 2020Quote: Toronto human knockout pooled library (TKOv3) was a gift from Jason Moffat and obtained from Addgene (#90294). It is a one-component library with guide-RNAs inserted in lentiCRISPRv2 backbone as well as the cas9 gene ...
-
bioRxiv - Genetics 2020Quote: The plasmid that contains the isoform 1 of human DNMT3B (DNMT3B1) was purchased from Addgene (cat # 35522). The DNMT3B1 cDNA was then fused to an N-terminal Flag tag by PCR ...
-
bioRxiv - Microbiology 2022Quote: Human Brunello CRISPR knockout pooled library was a gift from David Root and John Doench (Addgene #73178) and amplified according to instructions ...
-
bioRxiv - Microbiology 2024Quote: The human CRISPR (clustered regularly interspaced short palindromic repeats) “Brunello” lentiviral pooled library was purchased from Addgene. The library version in the lentiCRISPRv2 backbone was chosen ...