Labshake search
Citations for Addgene :
501 - 550 of 1452 citations for Human Gap Junction Alpha 8 Protein CX50 GJA8 ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: ... Full-length human ACE2 was a kind gift from Hyeryun Choe 22 (Addgene plasmid #1786).
-
bioRxiv - Immunology 2021Quote: The full human GeCKOv2 CRISPR knockout pooled library (Addgene #1000000048, a gift from Feng Zhang) was used for genome-wide screening40 ...
-
bioRxiv - Cell Biology 2021Quote: The Toronto human knockout pooled library (TKOv3) was a gift from Jason Moffat (Addgene #90294). The library was amplified in bacteria as described in the Moffat protocol on Addgene (https://www.addgene.org/pooled-library/moffat-crispr-knockout-tkov3/) ...
-
bioRxiv - Cell Biology 2021Quote: ... NPC1 human fibroblasts were transfected with either eGFP-Vector or eGFP-HSP70 (Addgene, Cat#15215) plasmid using an Amaxa human dermal fibroblast kit and manufacturer recommended U2OS protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... human MCU gRNA3 (hMCU gRNA1) was subcloned into the lentiCRISPR v2 backbone (Addgene, Plasmid #52961) and transfected into wild-type HEK293 cells via nucleofection as previously described ...
-
bioRxiv - Cancer Biology 2021Quote: GeCKO v2 human library made by Zhangfeng’s lab was purchased from Addgene (Watertown, MA, USA) amplified as described(Joung et al. ...
-
bioRxiv - Microbiology 2021Quote: Human furin was cloned in the sleeping beauty transposon plasmid26 pSB-bi-RP (Addgene #60513), transfected along with transposase ...
-
Sequence and structural variations determining the recruitment of WNK kinases to the KLHL3 E3 ligasebioRxiv - Molecular Biology 2020Quote: ... human KLHL3 (a.a. 298–587) was cloned into the pNIC28-Bsa4 vector (Addgene plasmid #110251), which provides an N-terminal hexahistidine tag as previously described [9] ...
-
bioRxiv - Molecular Biology 2020Quote: ... Smad3 overexpression plasmid was constructed by subcloning human Smad3 cDNA into pcDNA3.0 backbone plasmid (Addgene). GAS5 adenoviral vector was constructed by inserting mouse GAS5 cDNA into pShuttle-IRES-hrGFP-1 vector (Agilent) ...
-
bioRxiv - Genetics 2021Quote: ... The TERT-immortalized human melanocyte cell C283T was infected with pCW-Cas9-Blast from Addgene followed by introduction of lentiGuide-Puro (Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: U2OS cells harboring Doxycycline-inducible human RNF168 were generated using the pINDUCER20 lentiviral vector (Addgene plasmid # 44012 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The reference sgRNA sequences for human GeCKO v2.0 (A and B) were downloaded from Addgene (https://www.addgene.org/pooled-library/) ...
-
bioRxiv - Immunology 2020Quote: ... previously transfected with 500 ng of a human ACE2 expression plasmid (Addgene, Cambridge, MA, USA) were seeded at a density of 2 × 104 in 100 µL DMEM-10% in a white flat-bottomed 96-well plate one day prior to harvesting of SARS-CoV-2 pps ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Plasmids for the expression of myc-tagged human ACE2 (pCEP4-myc-ACE2, Addgene No. 141185), 8his-tagged monomeric sACE2 (ACE2 a.a ...
-
bioRxiv - Immunology 2020Quote: ... previously transfected with 500 ng of a human ACE2 expression plasmid (Addgene, Cambridge, MA, USA) were seeded at a density of 2 × 104 in 100 μL DMEM-10% in a white flat-bottomed 96-well plate one day prior to harvesting SARS-CoV-2 pps ...
-
bioRxiv - Neuroscience 2021Quote: ... the human Synapsin (hSyn) promoter in pAAV-hSyn-DIO-hM4D(Gi)-mCherry (Addgene, cat #: 50459) was replaced with mouse CaMKIIa promoter using MluI and SalI restriction sites to produce pAAV-CaMKII-DIO-hM4D(Gi)-mCherry and pAAV-CaMKII-DIO-mCherry ...
-
bioRxiv - Molecular Biology 2022Quote: The human metabolic knockout pooled CRISPR library was a gift from David Sabatini (Addgene # 110066). For lentivirus production ...
-
bioRxiv - Cell Biology 2022Quote: Full-length ERK3 wild type (WT) pDONR-223 construct purified from Human Kinase Library (Addgene) was used as a template to generate ERK3 K49A K50A kinase dead (KD ...
-
bioRxiv - Neuroscience 2024Quote: ... the coding sequence of human tau isoform 0N4R was subcloned into the pJFRC7 vector (Addgene, plasmid #26220 ...
-
bioRxiv - Cancer Biology 2024Quote: The Human CRISPR Metabolic Gene Knockout library was a gift from David Sabatini (Addgene #110066)78 ...
-
bioRxiv - Cell Biology 2024Quote: Human Pcdhga9 mutants were generated by cloning PCR-amplified fragments into pBob-GFP vector (Addgene). For GFP-tagged constructs ...
-
bioRxiv - Biochemistry 2023Quote: ... Human DNMT3A1 and DNMT3L constructs were PCR amplified from cDNA expression constructs (Addgene #35521, #35523) and cloned by ligation dependant cloning into x6His-MBP-TEV or 6xHis-MBP-GFP expression vectors ...
-
bioRxiv - Microbiology 2023Quote: ... GFP or human c-MET cDNA were PCR amplified from plasmid pLenti-MetGFP (Addgene #37560) and seamlessly cloned into the BamHI/XbaI sites of vector pLenti-spCas9-Blast (Addgene #52962) ...
-
bioRxiv - Neuroscience 2023Quote: Human iPSCs were edited using the pSpCas9(BB)-2A-GFP (PX458) construct backbone (Addgene #48138) described in Ran et al 201380 ...
-
bioRxiv - Cell Biology 2023Quote: Coding sequence of human PITX2C (NM_000325.6) was cloned into lentivirus transfer plasmid (pWPI, Addgene#12254) using Gibson Assembly® kit (NEB ...
-
bioRxiv - Systems Biology 2022Quote: ... 240 million cells were transduced with lentivirus from the Human Genome-wide CRISPRi-v2 (Addgene #83969 ...
-
bioRxiv - Microbiology 2023Quote: ... Human codon-optimized full-length Eph receptors were subcloned from pDONR223-EphB1 (Addgene # 23930 (82)) ...
-
bioRxiv - Biophysics 2023Quote: Human BAF57 and BAF155 gene fragments were amplified from plasmids pBS-hBAF57 (Addgene ID #17877) and pBS-hBAF155 (Addgene ID #17876) ...
-
bioRxiv - Microbiology 2023Quote: The human CUL1 and UBE2L3 coding sequences were amplified from pcDNA-HA-UBE2L3 (Addgene, #27561) and pcDNA-myc3-CUL1 (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... an shRNA targeting human UNK gene was cloned in the pLKO.1 puro plasmid (Addgene_8453) between AgeI and EcoRI sites61 ...
-
bioRxiv - Cancer Biology 2023Quote: ... TERT+ cells were transiently transfected with human CA-FOXO1 (pcDNA3 Flag-FKHR-AAA mutant; Addgene) (15) ...
-
bioRxiv - Cancer Biology 2023Quote: ... we amplified mutant human HIF1/2α using the pcDNA3-HA-HIF1α(P402A/P564A) (Addgene #18955) plasmid and the pcDNA3-HA-HIF2α(P405A/P531A ...
-
bioRxiv - Cell Biology 2024Quote: ... three target sequences were selected from the human CRISPR knockout pooled library (Brunello, Addgene #73178) and cloned into pSpCas9(BB)-2A-Puro (PX459 ...
-
bioRxiv - Biochemistry 2024Quote: ... the wild-type human VCPIP1 gene was purchased from Addgene (plasmid #22592 from Wade Harper) (28) ...
-
bioRxiv - Neuroscience 2024Quote: All viruses were purchased from Addgene containing EGFP under the control of the human synapsin promoter (Addgene plasmid # 50465; RRID: Addgene_50465). The serotypes included AAV1 ...
-
bioRxiv - Neuroscience 2024Quote: All viruses were purchased from Addgene containing EGFP under the control of the human synapsin promoter (Addgene plasmid # 50465; RRID: Addgene_50465). The serotypes included AAV1 ...
-
bioRxiv - Neuroscience 2021Quote: ... were added to each well along with 1 μl of Syn1-EBFP-Cre (serotype, 2-1; titer, 6×1012 genomes/mL; MOI, ∼8-0.08; Addgene, 51507-AAV1) delivered at full strength or diluted 1:103-104 ...
-
bioRxiv - Neuroscience 2021Quote: ... 8-12 weeks old Ucn3::Cre male mice were stereotaxically injected with pAAV-hSyn-DIO-hM3D(Gq)-mCherry (Addgene, Cambridge, MA) bilaterally into the PeFA (AP −0.6 ...
-
bioRxiv - Systems Biology 2020Quote: ... the cells were transfected with a mix of 8 μg lentiviral lentiCRISPRv2 vector containing the TKOv3 gRNA library 21 (Addgene #90294), 4.8 μg packaging vector psPAX2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and to the cell suspension was also added 8 ug of donor plasmid (AICSDP-52: HIST1H2BJ-mEGFP is Addgene plasmid # 109121). Cells were then electroporated using a Gene Pulser Xcell electroporation system at 160 V for 30 ms ...
-
bioRxiv - Biophysics 2022Quote: ... a pQE-30/pcl-ts ind+ plasmid containing a His6-SUMO SARS-CoV-2 nsp12 and untagged nsp7 & 8 (Addgene #160540) was transformed into E ...
-
bioRxiv - Cancer Biology 2021Quote: MEFs were seeded in 6-well plates and transfected for 6-8 h with 1 μg of plasmid 4XCLEAR-luciferase reporter (Addgene, 66800) and 0.1 ug of CMV-Renilla Luciferase (Promega ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... L2 assembly: L1 modules and annealed oligonucleotides (8-9, Table S5) assembled into the L2 destination vector pAGM4723-Del (Addgene #112207). The final plasmids ...
-
bioRxiv - Immunology 2024Quote: 8 x 105 293T cells were seeded in 6-well plate and transfected with pcDNA3-FLAG-VSVG plasmids (Addgene, plasmid 80606) for 24 hours with 50 μl of purchased or previously collected VSVΔG-Luc pseudovirus (Kerafast ...
-
bioRxiv - Neuroscience 2023Quote: We used AAV1-hSyn-GCaMP6f (2 × 1013 vg/mL Penn Vector Core/Addgene; diluted 1:8 to 1:15 in saline) for experiments involving two-photon calcium imaging of V1 layer 2/3 cells ...
-
bioRxiv - Cancer Biology 2023Quote: ... sgRNA vectors for each given condition (OE, KO, NT) were pooled and co-transfected with pAdH helper plasmid and pAAV2/8 capsid (Addgene, #112864) with polyethylenimine (PEI) ...
-
bioRxiv - Cell Biology 2024Quote: sgRNA sequences targeting Atg7 (CACCGTCTCCTACTCCAATCCCGTG), Pcyt2, (CACCGCCATGATCCGGAACGGGCA) or a non-genic region on mouse chromosome 8 (Chr8, ACATTTCTTTCCCCACTGG) were cloned into lentiCRISPRv2 (Addgene, 52961). sgRNA sequences targeting Trp53 (GAAGTCACAGCACATGACGG ...
-
bioRxiv - Biochemistry 2024Quote: ... The DIvA cells were plated 24 h before experiments onto 8 well ibidi glass bottom dishes and transiently transfected with eGFP-53BP1 (Fradet-Turcotte A, 2013) (Addgene #60813) via use of Lipofectamine 3000 according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2024Quote: ... To determine MOI and approximation of appropriate viral volume we infected day 14 iGLUTs (0, 1, 2, 4, 8, 10, 16, 32, 64 µL) with control lentivirus (pLS-SV40-mP-EGFP; AddGene #137724) and harvested for 48hrs later ...
-
bioRxiv - Biophysics 2024Quote: The genes encoding for full-length and truncated versions of N-protein (Uniprot: P0DTC9) were PCR-amplified from a vector with the cDNA of N-protein acquired from Addgene (pGBW-m4046785; Plasmid #145684). The CC null mutants in which L223 ...