Labshake search
Citations for Addgene :
801 - 850 of 1452 citations for Human Gap Junction Alpha 8 Protein CX50 GJA8 ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... harboring the full-length cDNA of human wild type Androgen receptor (AR) (Addgene plasmid # 89078; http://n2t.net/addgene:89078; RRID: Addgene_89078) was procured from Addgene [17] ...
-
bioRxiv - Genomics 2022Quote: ... elegans Vector Kit was a gift from Andrew Fire (Addgene kit # 1000000001). A translational reporter was later generated by synthesizing the remainder of the coding sequence (IDT ...
-
bioRxiv - Developmental Biology 2024Quote: ... worms were grown on bacteria expressing double stranded RNA for him-8/klp-16 using the pLT 651 plasmid (Addgene plasmid # 59998, Timmons et al., 2014).
-
bioRxiv - Neuroscience 2024Quote: ... female mice at 8-12 weeks of age underwent stereotaxic injections with pGP-AAV9-syn-FLEX-jGCaMP8s-WPRE (#162377, Addgene, titer: 2.7 x 1013 gc/mL) with the same surgical procedure as described above ...
-
bioRxiv - Neuroscience 2020Quote: ... Retrograde adeno associated viruses encoding green fluorescent protein (Addgene, Catalog number 50465-AAVrg) or tdtomato (Addgene ...
-
bioRxiv - Physiology 2021Quote: ... Fluorescent protein sequences were PCR-derived from pmVenus(L68V)-mTurquiose2 (Addgene plasmid #60493), Gamillus/pcDNA3 (Addgene plasmid #124837) ...
-
bioRxiv - Cell Biology 2020Quote: ... SpCas9 protein generated from the expression plasmid pET-NLS-Cas9-6xHis (Addgene #62934) was purified according to (Zuris et al. ...
-
bioRxiv - Developmental Biology 2021Quote: DR274 gRNA plasmids and Cas 9 protein were from Addgene (Cambridge Massachussets, USA) and New England Biolabs (Ipswich ...
-
bioRxiv - Molecular Biology 2020Quote: ... A plasmid expressing anti-CRISPR protein (pEJS581; pCSDest2-AcrIIC4Hpa-FLAG-NLS; Addgene # 113436) was included in the triple-transfection packaging process to maintain intact rAAV:HDR:cleaved plasmids during production ...
-
bioRxiv - Molecular Biology 2022Quote: ... Plasmid pcDNA3-YFP (for YFP protein) was a gift from Doug Golenbock (Addgene plasmid #13033 ...
-
bioRxiv - Genomics 2024Quote: ... the expression plasmids (pRha-ABE8e-NRCH, Addgene #165417; and pABE8e-protein, Addgene #161788) were transformed into BL21Start DE3 competent cells (Thermo) ...
-
bioRxiv - Cancer Biology 2024Quote: Pre-Intact clone was infected with pLV-Azurite (blue fluorescent protein, Addgene, 36086) and Pre-ARSIR1 clone was infected with SGEP-Renilla-713 (GFP ...
-
bioRxiv - Systems Biology 2023Quote: ... and to amplify the fluorescent proteins from plasmids (SYFP2 from pSYFP2-C1 Addgene #22878 ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNAs were subcloned into the pMSCV-IRES-green fluorescence protein vector (Addgene #20672) with reference to a report by Masubuchi et al.43 The constructed plasmid was validated by sequencing prior to use.
-
bioRxiv - Microbiology 2023Quote: ... All other SARS-CoV-2 viral protein-encoding plasmids were obtained from Addgene in the pLVX-EF1a-IRES-puro backbone (Addgene #141367-141370 ...
-
bioRxiv - Physiology 2024Quote: ... encoding the NMDAR-NR1 subunit tagged with an enhanced yellow protein (EYFP) (Addgene plasmid #17928 ...
-
bioRxiv - Biochemistry 2024Quote: ... The expression and purification of MOZ protein (pET28a-LIC-MOZ plasmid, Addgene #25181) were done according to the protocol from Structural Genomics Consortium (SGC ...
-
bioRxiv - Synthetic Biology 2023Quote: ... We used DNA parts provided with the EMMA cloning kit (Addgene kit # 1000000119) and generated DNA fragments by PCR using Platinum™ SuperFi II Green PCR Master Mix (ThermoFisher ...
-
bioRxiv - Immunology 2021Quote: ... The human full length (HFL) gene sequence was subcloned from pcDNA5/FRT/TO HIS HSPA1A (a gift from Harm Kampinga, Addgene plasmid # 19537 ...
-
bioRxiv - Neuroscience 2021Quote: ... were infused bilaterally with AAV expressing the inhibitory designer receptor human M4 muscarinic receptor (hM4Di; AAV8-hSyn-hM4Di-mCherry, 4.8 × 1012 or 3.7 × 1012 vg/mL; Addgene; 0.3 μL) at a rate of 0.1 μL/min into the mOFC (AP ...
-
bioRxiv - Neuroscience 2022Quote: The pCMV-hEAAT2 plasmid encoding the human excitatory amino acid transporter type 2 (EAAT2) was a gift from Susan Amara (Addgene plasmid # 32814 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The expression vectors of the full-length SARS-CoV-2 spike and the human serine protease TMPRSS2 with a C-terminal C9-tag (TETSQVAPA) were acquired from AddGene (Summit Pharmaceutical International ...
-
bioRxiv - Cell Biology 2020Quote: ... pLV-pEF1α-mNeonGreenPXN was generated by cloning of a sequence encoding human paxillin (PXN) from pmCherry Paxillin (a gift from Kenneth Yamada, Addgene plasmid #50526 ...
-
bioRxiv - Cell Biology 2021Quote: ... Source of different elements are as follows: LAMP1 signal peptide and human LAMP1 were PCR amplified from LAMP1-mGFP (Addgene Plasmid #34831 ...
-
bioRxiv - Biochemistry 2020Quote: ... and FMRP was purchased as a gene block from IDT. The human sequence (not optimized for E. coli) for FXR1P was purchased from Addgene. The genes coding for the human fragile X proteins (FMRP isoform 1 NCBI Reference Sequence ...
-
bioRxiv - Bioengineering 2020Quote: ... and mRuby2-tagged Lifeact were constructed by inserting the PCR-amplified cDNAs (human TAGLN2, pFN21ASDA0120, Kazusa DNA Research Institute; Lifeact, Addgene plasmid # 54688 ...
-
bioRxiv - Biochemistry 2020Quote: ... H-HCF-1) and full length human THAP11 cDNA with carboxy-terminal FLAG tag (Plasmid #28020; F-THAP11) were obtained from Addgene. Vectors containing full length human THAP1 cDNA with carboxy-terminal 1X FLAG tag (THAP1-F ...
-
bioRxiv - Neuroscience 2021Quote: ... The GCaMP6s reporter was expressed in neurons under the human synapsin promoter following successful AAV transduction (AAV1-hSyn1-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA, AddGene). Briefly ...
-
bioRxiv - Cancer Biology 2020Quote: HEK-293T cells were transfected with the human PSD4 containing pLV lentivirus (VB160428-1095xdp – Vector Builder) together with the 3rd generation lentiviral packaging plasmid (Addgene): pMDLG/pRRE (Gag and Pol) ...
-
bioRxiv - Plant Biology 2020Quote: The human codon-optimized CAS9 with 2×35S CaMV promoter and Nos terminator was amplified from pAGM4723 plasmid (Addgene# 49772) using KpnI forward and PacI reverse primers (Supplemental Table 9) ...
-
bioRxiv - Neuroscience 2020Quote: ... P5-7 WT C57Bl/6 mice were used for the injection of AAV9 virus under human synapsin promoter (pAAV9.hSyn.iGluSnFR, commercially available from Addgene, USA) to drive transgenic expression of iGluSnFR in SGNs ...
-
ORAI1 establishes resistance to SARS-CoV-2 infection by regulating tonic type I interferon signalingbioRxiv - Microbiology 2021Quote: ... CACCGGATCGGCCAGAGTTACTCC; Reverse primer: AAACCGGAGTAACTCTGGCCGATCC) and human STIM1 (Forward primer: CACCGTGAGGATAAGCTCATCAGCG; Reverse Primer: AAACCGCTGATGAGCTTATCCTCAC) genes were subcloned into pLentiguide puro (Addgene). sgRNAs targeting human interferon alpha and beta receptor subunit 1 (IFNAR1 ...
-
bioRxiv - Genomics 2020Quote: ... Plasmids for human LINE-1 expression: pBS-L1PA1-CH-mneo (CMV-LINE-1) was a gift from Astrid Roy-Engel (Addgene plasmid # 51288 ...
-
bioRxiv - Cancer Biology 2021Quote: Human H-RasG12V cDNA sequence was cloned into LeGO-iV2 and LeGO-iC2 bicistronic vectors (Addgene #27344 and #27345, respectively). Retroviruses were produced by JetPEI (Polypus-Transfection ...
-
bioRxiv - Cell Biology 2021Quote: ... The fragments of 5’ and 3’ homology arms of ORACLE-OCT4 (exo) were replaced using human OCT4-2a-eGFP-PGK-Puro (#31938, Addgene) to target endogenous OCT4 locus with modification ...
-
bioRxiv - Molecular Biology 2020Quote: Human Drosha cDNA with a Flag-tag at the amino-terminus was cloned into pBABE-puro vector (Addgene plasmid#1764) for producing retrovirus of human Drosha wild type (WT) ...
-
bioRxiv - Neuroscience 2022Quote: ... The gRNAs targeting human AMPK α1 or α2 described previously were cloned into the gRNA/Cas9 expression vector pLenti-CRISPR v2 (Addgene) 91 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were immortalized by human telomerase gene (hTERT) using the retrovirus vector pLXSN-hTERT or the lentivirus vector pCLX-PGK-hTERT vector (#114315, Addgene). Retrovirus and lentivirus preparations ...
-
bioRxiv - Neuroscience 2020Quote: ... Human His-tagged SETD1A expression pET28-SETD1A-MHL plasmid and its control pET28-MHL were gifts from Cheryl Arrowsmith (Addgene plasmid # 32868 and #26096 ...
-
bioRxiv - Cell Biology 2021Quote: ... The constitutively active form of kinesin-1 (human KIF5B, K560) was cloned by PCR from pet17-K560-GFP_His (Addgene, 15219) into pEGFP-N1 vector using EcoRI primer (104-5p EcoRI-K560 ...
-
bioRxiv - Biochemistry 2021Quote: DNA encoding human RTCB was cloned into the UC Berkeley MacroLab 4B vector (gift from Scott Gradia, Addgene plasmid #30115). The fusion protein containing an N-terminal His6 tag and a TEV protease cleavage site was expressed in Sf9 insect cells using the Bac-to-Bac Baculovirus expression system (Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: ... and FLAG-tagged FL human TSC2 (1807 amino acids, UniProtKB/Swiss-Prot accession number P49815- 1) were purchased from Addgene, and pRK7 was subcloned with FLAG-tagged human TBC1D7 (293 amino acids ...
-
bioRxiv - Biochemistry 2021Quote: ... Pichia pastoris expression vector pPICZc carrying human β-actin fused with thymosin β4 and 6xHis-tag was a gift from Mohan Balasubramanian (Addgene #111146, RRID:Addgene_111146). β-Actin cDNA was mutated to introduce K50C and C374A for labeling with a cross-linking reagent ...
-
bioRxiv - Immunology 2020Quote: ... 1.5ugs of each hU6_sgRNAs and 3ugs a plasmid expressing human codon-optimised CAS9 driven by the CMV promotor (Addgene # 41815). 48 hours post transfection the media was changed for G418 selection media ...
-
bioRxiv - Microbiology 2021Quote: ... we cloned the human ACE2 cDNA sequence (NP_001358344.1) into a pLV-EF1a-IRES-Puro backbone vector (Addgene, cat no. 85132), and prepared lentiviral particles as described previously65 ...
-
bioRxiv - Genomics 2021Quote: Toronto human knockout pooled library (TKOv3) containing 71,090 based on a lentiCRISPRv2 backbone was a gift from Jason Moffat (Addgene #90294). The library was transformed and amplified using 25 μl Endura Competent Cells (Lucigen ...
-
bioRxiv - Genetics 2020Quote: Two pairs of gRNAs (Table S1 in “Supplementary file”) intermediated by human U6 (hU6) promoter were cloned after hU6 promoter of the plentiCRISPR_V2 plasmid (Addgene, #52961), according to Vidigal et al.’s protocol 34 ...
-
bioRxiv - Cell Biology 2022Quote: ... BirA-ACLY constructs were generated by inserting human ACLY into pcDNA3.1 mycBioID vector (N-terminal MYC-BirA, Addgene, plasmid 35700) with a 16 or 46 amino acid linkers between ACLY and BirA ...
-
bioRxiv - Biophysics 2022Quote: ... and 32C (residues 172–270 of RPA2) domains of human RPA were PCR amplified using p11d-tRPA plasmid (Addgene plasmid102613) (Henricksen et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... pMSCV-p19Ink4d-IRES-GFP plasmid expressing mouse p19INK4d (sharing 87% sequence identity with human p19INK4d) (61) was obtained from Addgene.