Labshake search
Citations for Addgene :
601 - 650 of 2604 citations for 6H 5 Oxa 1 2a 4a triazacyclopenta cd pentalene 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... EF1a-CasRx-2A-EGFP was a gift from Patrick Hsu (Addgene plasmid # 109049 ; http://n2t.net/addgene:109049 ; RRID:Addgene_109049). Following oligos were used for cloning ...
-
bioRxiv - Molecular Biology 2023Quote: The gRNAs used to knock-out LIG4 were cloned in the pSpCas9(BB)-2A-GFP (pX458) (Addgene #48138). The gRNA used for IncucyteS3 experiments was cloned into a pLenti-gRNA-GFP-2A-PURO gift from Jordan Young from Repare Therapeutics ...
-
bioRxiv - Neuroscience 2022Quote: ... Lipofectamine3000 was used to transfect cells with 0.5ug of pSpCas9(BB)-2A-GFP(PX458) targeting plasmid (Addgene # 48138) containing sgRNA sequences targeting full-length or truncations in SRRM2 and PNN (Supplemental Table 3) ...
-
bioRxiv - Cell Biology 2022Quote: Plasmids encoding GFP-2A-ORF6 were generated by inserting EGFP-T2A sequence (copied from Addgene #140424 by PCR) at the 5’ end of the ORF6 gene in pSecTag2 mammalian expression vector using Gibson Assembly ...
-
bioRxiv - Cell Biology 2022Quote: ... pSpCas9(BB)-2A-Puro (PX459) and lentiCRISPR v2 were gifts from Feng Zhang (Addgene plasmids #48139 and #52961). pLG1-puro non-targeting sgRNA 3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 17 as a template and inserted into pXR002: EF1a-dCasRx-2A-EGFP (a gift from Patrick Hsu; Addgene plasmid #109050 ...
-
bioRxiv - Molecular Biology 2023Quote: pSpCas9(BB)-2A-Puro (PX459) was a gift from Feng Zhang (Addgene plasmid #48139; http://n2t.net/addgene:48139;RRID:Addgene_48139). Cas9 sgRNAs targeting the RTCB gene were cloned as previously described (table S2 ...
-
bioRxiv - Molecular Biology 2023Quote: ESCs were co-transfected with 1000 ng of pX458 SpCas9(BB)-2A-GFP vector (Addgene #48138, contains eGFP)80 and 500 ng of vector co-expressing four sgRNAs to the Peg13 DMR CTCF region (contains DsRed ...
-
bioRxiv - Genetics 2023Quote: ... Guide RNAs TTCTTCAGACTTCAGAACAT or CTGAAGAAAATTTACAAATC were cloned into the pSpCas9(BB)-2A-GFP plasmid (pX458; Addgene plasmid 48138) and used in a co-transfection ...
-
bioRxiv - Biophysics 2023Quote: ... The gRNA sequence (GCGGCCGGGCTCCATGGCGC) was cloned into pSpCas9(BB)-2A-GFP (Addgene, PX458; deposited by Dr. Feng Zhang). The replacement DNA was designed to contain 700 bps of the homologous region for both sides of the inserted mEos2 sequence ...
-
bioRxiv - Bioengineering 2022Quote: ... the annealed gRNA oligos were cloned into the BbsI site of the pSpCas9(BB)-2A-BSD plasmid (Addgene plasmid # 118055 ...
-
bioRxiv - Developmental Biology 2023Quote: ... pSpCas9(BB)-2A-GFP (PX458) was a gift from Feng Zhang (Addgene plasmid # 48138; http://n2t.net/addgene:48138; RRID:Addgene_48138).
-
bioRxiv - Molecular Biology 2023Quote: ... and cloned into pSpCas9(BB)-2A-GFP (pSpCas9(BB)-2A-GFP (PX458) was a gift from Feng Zhang (Addgene plasmid # 48138 ; http://n2t.net/addgene:48138 ; RRID:Addgene_48138). The guide sequence containing Cas9 vector and pmCherry-C1 empty vector (3 ug each ...
-
bioRxiv - Cell Biology 2023Quote: ... gRNAs were annealed and ligated into a BbsI-digested pSpCas9(BB)-2A-Puro (PX459) V2.0 vector (Addgene #62988). HeLa cells were transfected with the gRNA-containing plasmid using the JetOptimus (Polyplus ...
-
bioRxiv - Cell Biology 2023Quote: ... PhOTO-M (pMTB:memb-Dendra2-2A-H2B-Cerulean) was a gift from Periklis Pantazis (Addgene plasmid # 92401; http://n2t.net/addgene:92401; RRID:Addgene_92401), pHTC HaloTag® CMV-neo vector was purchased from Promega ...
-
bioRxiv - Genomics 2023Quote: ... EF1a-dCasRx-2A-EGFP was a gift from Patrick Hsu (Addgene plasmid # 109050; http://n2t.net/addgene:109050; RRID:Addgene_109050))(19 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were transfected with the pCAG-eSpCas9-2A-GFP (generous gift from Jizhong Zou, Addgene plasmid #79145; http://n2t.net/addgene:79145; RRID:Addgene_79145) plasmid co-expressing the S ...
-
bioRxiv - Molecular Biology 2023Quote: ... The gRNA sequence (TCGGATGCGTTTATATACGG) was cloned into the pRS1208 – pSpCas9(BB)-2A-Puro (PX459) plasmid (Addgene plasmid #48139). The mCerulean sequence was replaced by EGPF using SLIC protocol56 in the mCerulean_p2a_neo C-Terminal Fusion (Plasmid 1A)57 ...
-
bioRxiv - Bioengineering 2024Quote: ... pSpCas9(BB)-2A-GFP (PX458) was a gift from Feng Zhang (Addgene plasmid # 48138; http://n2t.net/addgene:48138; RRID:Addgene_48138). PX458 was digested by EcoRI ...
-
bioRxiv - Neuroscience 2024Quote: ... pSpCas9(BB)-2A-GFP (PX458) was a gift from Feng Zhang (Addgene plasmid #48138; http://n2t.net/addgene:48138; RRID:Addgene_48138). pU6-(BbsI)_CBh-Cas9-T2A-mCherry was a gift from Ralf Kuehn (Addgene plasmid #64324 ...
-
bioRxiv - Molecular Biology 2023Quote: ... the PRKRA CDS (amplified from a Mael-/- testis cDNA sample) and the P2A-EGFP-ori-AmpR fragment (from Addgene #112101).
-
bioRxiv - Immunology 2023Quote: DNA inserts containing the coding DNA sequence (CDS) for each wild type gene were generated by restriction digestion previous amplification from plasmids obtained from Addgene (hMX1 ...
-
bioRxiv - Neuroscience 2023Quote: ... Suppl Fig 3: AAV9-CaMKIIa-hChR2-EYFP (1:5, Addgene viral prep #26969- AAV9 ...
-
bioRxiv - Cancer Biology 2021Quote: SPRY2 CRISPR oligonucleotides used in H1299 cells (gRNA target site: GTACTCATTGGTGTTTCGGA) were cloned into pSpCas9(BB)-2A-Puro (Addgene plasmid #62988 ...
-
Oxidative and non-oxidative active turnover of genomic methylcytosine in distinct pluripotent statesbioRxiv - Cell Biology 2020Quote: ... The oligonucleotides were annealed and cloned in the BbsI site of pSpCas9-2A-Puro (PX 459; Addgene Plasmid 48139)58 ...
-
bioRxiv - Cell Biology 2020Quote: ... different guide RNAs targeting FABP4 or FABP5 were designed (crispr.mit.edu) and oligos including the targeting sequences were annealed and cloned into pSpCas9n(BB)-2A-GFP (PX461; Addgene #48140), used for targeting FABP4 ...
-
bioRxiv - Cell Biology 2022Quote: To generate the PX459 with single guide RNA (sgRNA) sequences, pSpCas9(BB)-2A-Puro (PX459) V2.0 (Ran et al., 2013)(purchased from Addgene) was digested with FastDigest BbsI (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2020Quote: ... this line (148.4) was derived from E14 mouse ES cells and is homozygous for a Tir1-2A-Puro cassette (Addgene plasmid # 92142 ...
-
bioRxiv - Developmental Biology 2019Quote: ... The repair template for NHEJ-mediated knock-in [3xP3:Tc’v-SV40-Cre-2A-EGFP:bhsp68-eb] was cloned into the pJET1.2 vector (Addgene plasmid #124068). For linearizing the plasmid ...
-
bioRxiv - Neuroscience 2019Quote: ... Oligos encoding the five sgRNAs were individually cloned into the pSpCas9(BB)-2A-Puro (PX459) V2.0 vector (Addgene #62988) and transfected into HEK293 cells ...
-
bioRxiv - Synthetic Biology 2021Quote: ... while pEN435 - pCAGGS-TagBFP-hGeminin-2A-mCherry-hCdt1- rbgpA-Frt-PGK-EM7-PuroR-bpA-Frt Tigre targeting (Addgene #9213925) was used as template for both hGeminin and hCdt1 tags ...
-
bioRxiv - Cell Biology 2021Quote: Double stranded oligonucleotides of the guide sequences (with a substitution of a G for the first nucleotide to facilitate expression from the U6 promotor) were cloned into the pSpCas9(BB)-2A-Puro (PX459) V2.0 Vector (Addgene) at the BbsI sites ...
-
bioRxiv - Cancer Biology 2020Quote: CRISPR-Cas9-mediated knockout was delivered by pSpCas9 (BB)-2A-GFP (PX458) (Plasmid #48138, Addgene, and Cambridge, MA, USA). Sequences of sgRNAs are listed in the following supplementary table S2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Complementary gRNA oligonucleotides were annealed and ligated to BbsI-digested pSpCas9(BB)-2A-Puro plasmid (Addgene plasmid ID# 48139) using Quick Ligation Kit (New England Biolabs) ...
-
bioRxiv - Cell Biology 2019Quote: ... single guide RNA (GTAATACCTATGAAGAGTAA) was cloned into pX458-pSpCas9(BB)-2A-GFP (gift from Feng Zhang, Addgene plasmid #48138) via BbsI restriction site ...
-
bioRxiv - Cell Biology 2021Quote: ... Two plasmids were made by adding their respective guides into CrisprV2pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene Plasmid #62988). Cells were passaged in single cell suspension and plated at 50% confluence ...
-
bioRxiv - Neuroscience 2020Quote: ... that target exon 2 of human LRRK2 genomic sequence was subcloned into plasmid pSpCas9(BB)-2A-Puro(PX459) V2.0 (a gift from Feng Zhang, Addgene, Plasmid #62988 ...
-
bioRxiv - Cell Biology 2021Quote: ... and subsequent DrdI/KpnI-subcloning of the entire dual sgRNA expression cassette into pSpCas9(BB)-2A-miRFP670 (Addgene #91854). To run the EJ5-GFP assay ...
-
bioRxiv - Neuroscience 2022Quote: ... We selected the TSC2Ex2-gRNA (TGTTGGGATTGGGAACATCGAGG) and cloned it into the Cas9-containing plasmid pSpCas9(BB)-2A-GFP (Addgene) as described (Ran et al ...
-
bioRxiv - Microbiology 2022Quote: ... the forward and reverse strand oligodeoxynucleotides were annealed and ligated into pSpCas9(BB)-2A-GFP (Addgene, PX458, Plasmid #48138) linearized with BbsI (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... [pSpCas9(BB)-2A-Puro(PX459) was a gift from Feng Zhang (Addgene plasmid #62988; http://n2t.net/addgene:62988; RRID: Addgene_62988)] ...
-
bioRxiv - Molecular Biology 2022Quote: ... sgRNAs were designed using the CRISPOR online tool (http://crispor.tefor.net) and oligonucleotides encoding sgRNAs were cloned into the pSpCas9(BB)-2A-Puro plasmid as previously described (Addgene #62988)91 ...
-
bioRxiv - Cancer Biology 2019Quote: ... and Pten-/-;sgEmpty] were generated using pSPCas9(BB)-2A-Puro (PX459) V2.0 that was a gift from Feng Zhang (Addgene plasmid # 62988 ...
-
bioRxiv - Cell Biology 2019Quote: ... pSpCas9(BB)-2A-GFP (PX458) was a gift from Feng Zhang (Addgene plasmid # 48138; http://n2t.net/addgene:48138; RRID:Addgene 48138) [21] ...
-
bioRxiv - Neuroscience 2020Quote: ... to measure BLA ACh levels (Fig. 2A-E + S2.1-S2.2) or 0.5 µL of AAV1 Syn-FLEX-GCaMP6s-WPRE-SV40 (Addgene, Watertown, MA) to measure BLA principal cell calcium dynamics (Fig ...
-
bioRxiv - Biochemistry 2021Quote: The guide RNA sequence CAGAATTGGCGCTATGCTAC targeting exon 7 of FUT8 was cloned into px458 pSpCas9(BB)-2A-GFP (Addgene). The resulting plasmid was transfected into Huh7 cells using ViaFect (Promega ...
-
bioRxiv - Cell Biology 2022Quote: ... This again was followed by the cloning of these sgRNAs into the bicistronic Cas9n expression vector pSpCas9n(BB)-2A-Puro (PX462) V2.0 (Ran et al, 2013b) kindly provided by Feng Zhang (Addgene plasmid #62987 ...
-
bioRxiv - Developmental Biology 2020Quote: ... PX459-sgRosa26-1 was generated by inserting the guide RNA sequence targeting Rosa26 (Table S3) into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene) via restriction ligation with BbsI.
-
bioRxiv - Cell Biology 2021Quote: ... During sgRNA cloning the pSpCas9(BB)-2A-GFP (pX458) was used (a gift from Feng Zhang, Addgene plasmid #48138, http://n2t.net/addgene:48138, RRID: Addgene_48138). CTSD was targeted using the gRNA ...
-
bioRxiv - Cell Biology 2020Quote: The PIK3C2A knockout cell line was generated by transfecting HeLa cells with pSpCas9(BB)-2A-GFP (pX458, Addgene #48138) into which a single guide (5’-CACCGAGCACAGGTTTATAACAAGC-3’ ...