Labshake search
Citations for Addgene :
801 - 850 of 2604 citations for 6H 5 Oxa 1 2a 4a triazacyclopenta cd pentalene 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: We assembled the CRISPR/Cas9 vectors by annealing pairs of oligos carrying the sgRNA sequences and cloning them into pSpCas9(BB)-2A-Puro (PX459) (Addgene #62988) as described60 ...
-
bioRxiv - Cancer Biology 2023Quote: ... that created a double stranded break close to the mutation (sequence: CCAGATCCACTGCTGTCAGG) and cloned in pSpCas9(BB)-2A-Puro (Addgene, 48139).
-
bioRxiv - Neuroscience 2023Quote: ... we generated small guide RNAs to PAM sites in proximity to exons 4 and 7 of the murine Grik3 locus and cloned these into the pSpCas9(BB)-2A-GFP (PX458) backbone (Addgene #48138), where expression of the sgRNAs is controlled under the U6 promoter ...
-
bioRxiv - Cell Biology 2023Quote: STING1 KO HMC3 cells were generated using the pSpCas9(BB)-2A-Puro (PX459) V2.0 vector kindly gifted by Feng Zhang (Addgene plasmid #62988)73 containing the following single guide RNA (sgRNA ...
-
bioRxiv - Cell Biology 2023Quote: ... targeting a common exon of splicing variants of each gene of interest were cloned into BBsI-linearised pSpCas9(BB)-2A-GFP vector (Addgene #48138) using NEBuilder® HiFi DNA Assembly (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: ... The annealed oligos were diluted 250-fold with water and used for ligation with the pSpCas9(BB)-2A-Puro (PX459) V2.0 vector (Addgene, Cat# 62988), which was predigested with BbsI-HF (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... LS174T ERN1-/- cells and LS174T ERN2-/- cells were constructed by transfection with pSpCas9(BB)-2A-GFP (Feng Zhang lab, Addgene #48138) containing sequences for guides targeting exon 8 (WGE ID’s 1150303698 and 1150303744 for ERN1 ...
-
bioRxiv - Genomics 2023Quote: ... and HA-tag were introduced by CRISPR/Cas9-mediated homologous recombination to the N-terminus of ZBTB24 protein (gRNAs are listed in Table S9 were cloned in pSpCas9(BB)-2A-GFP (PX458) (Addgene #48138), the plasmids containing HA tag ...
-
bioRxiv - Cell Biology 2023Quote: ... They were then cloned into a pCCC vector which is based on pSpCas9(BB)-2A-GFP vector (PX458, Addgene plasmid # 48138). The pCCC vector contains the complete U6 promoter for enhanced expression in hiPSCs ...
-
bioRxiv - Genomics 2023Quote: ... This integration was generated by co-transfection of the donor vector pEN396-pCAGGS-Tir1-V5-2A-PuroR TIGRE (Addgene plasmid, #92142) and Cas9-gRNA plasmid pX459-EN1201 (backbone from Addgene plamid #62988 ...
-
bioRxiv - Cell Biology 2023Quote: ... the oligonucleotides were annealed and cloned into the BbsI site of dual Cas9 and sgRNA expression vector pSpCas9(BB)-2A-Puromycin (Dr. Feng Zhang laboratory, Addgene, #48139). The plasmids were transfected into HeLa cells using TurboFect Transfection Reagent (Invitrogen) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Initiative for Genome Editing and Neurodegeneration core in the Department of Cell Biology at Harvard Medical School) or cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid # 62988) and transfected into HEK293FT using Lipofectamine 2000 (ThermoFisher) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... the mouse synaptophysin-mRuby fusion protein was cloned into the generated synapsin:eGFP transgene from AAV-FLExloxP-mGFP-2A-synaptophysin-mRuby (Addgene Plasmid# 71760) plasmid vector courtesy of Liqun Luo (Beier et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... This phosphorylated DNA fragment was ligated to the Bbs I cloning site in pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid # 62988) [16] ...
-
bioRxiv - Cell Biology 2023Quote: ... targeting exons 6 or 10 of CTPS1 or exons 5 and 10 of CTPS2 were designed as previously described [39] and cloned in the LentiCRISPR V1 (pXPR_001) or pSpCas9(BB)-2A-GFP (PX458) (Addgene plasmid 48138) vectors ...
-
bioRxiv - Cancer Biology 2023Quote: ... were made by ligation of double-stranded antisense/sense oligos to the short guide RNAs (sgRNAs) of interest in pSpCas9(BB)-2A-GFP (PX458; Addgene #48138) and pSpCas9(BB)-2A-RFP plasmids ...
-
bioRxiv - Developmental Biology 2023Quote: A sgRNA targeting the arginine finger region of SYNGAP1 was cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid #62988). This ...
-
bioRxiv - Developmental Biology 2023Quote: A sgRNA targeting the patient-specific mutation in SYNGAP1 was cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid #62988). This ...
-
bioRxiv - Neuroscience 2023Quote: ... An additional round of CRISPR/Cas9 genome editing was performed on one clonal cell line to further disrupt the coding region of endogenous Scn9a using recombinant pX458 plasmid (pSpCas9-2A-GFP; Addgene #48138) and a gRNA targeting the in-frame deletion (Scn9a ...
-
bioRxiv - Neuroscience 2023Quote: ... ENST00000396265.4 TSPO-203) using Benchling (Benchling software, 201941) and cloned into either a pSpCas9(BB)-2A-GFP (PX458; Addgene plasmid #48138) plasmid or a pU6-(BbsI)_CBh-Cas9-T2A-mCherry plasmid (Addgene plasmid #64324 ...
-
bioRxiv - Molecular Biology 2023Quote: An sgRNA targeting the ZFC3H1 gene around the ATG translation start site was cloned in pSpCas9 (BB)-2A-GFP plasmid (Addgene #48138). The plasmid was then transfected into HEK-293T cells along with a single stranded oligodeoxynucleotide (ssODN ...
-
bioRxiv - Neuroscience 2023Quote: ... The double-strand DNAs containing the gRNA sequence were synthesized and subcloned into the MluI/SpeI site of pAAV-FullH1TO-SaCa9sgRNAi(CREB)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA (Addgene, #113702) (44) ...
-
bioRxiv - Cancer Biology 2023Quote: Single guide RNA (sgRNA) targeting ARID1A (Table S5) were cloned into the pSpCas9(BB)-2A-GFP backbone (PX458, Addgene plasmid #48138) as previously described (44) ...
-
bioRxiv - Cell Biology 2023Quote: ... Oligonucleotides for cloning guide RNA into the pSpCas9 (BB)-2A-GFP vector (48138; a gift from F. Zhang, Addgene, Cambridge, MA) were designed as described previously (Ran et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... These oligos which contain BbsI restriction sites were annealed creating overhangs for cloning of the guide sequence oligos into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid #62988) by BbsI digestion ...
-
bioRxiv - Immunology 2023Quote: ... sgRNA was then inserted into pSpCas9(BB)-2A-GFP (PX458) vector [44] that was provided by Feng Zhang (Addgene plasmid #48138). List of sgRNA target sequences to prepare the ABIN1 knock-out ...
-
bioRxiv - Cell Biology 2024Quote: ... were generated by simultaneously targeting RNF43 (gRNA: ATTGCACAGGTACAGCGGGT) and ZNRF3 (gRNA: GCCAAGCGAGCAGTACAGCG) with gRNAs cloned in a pSpCas9(BB)-2A-Puro vector (Addgene # 48139). Monoclonal cell lines that were homozygous knockout for both genes were confirmed by genotyping and functional analysis in a β-catenin-mediated reporter assay (Fig ...
-
bioRxiv - Genetics 2024Quote: A CRIPSR guide for the SCN5A E171Q mutation was designed using the CRISPOR online tool.20 We cloned the guide sequence (AATCTTGACCAGAGACTCAA-AGG) into SpCas9-2A-GFP (pX458, Addgene #48138)21 by annealing complementary primers 5’CACCGAATCTTGACCAGAGACTCAA and 5’AAACTTGAGTCTCTGGTCAAGATTC ...
-
bioRxiv - Immunology 2024Quote: ... were transfected with 100ng MSCV plasmid (MSCV multiple cloning site IRES puroR 2A mCherry or GFP) and 10ng pVSVg plasmid (Addgene 8454) with Lipofectamine 2000 (Thermo) ...
-
bioRxiv - Cancer Biology 2024Quote: ... A modified cloning strategy was used to clone the two gRNA into pSpCas9(BB)-2A-Puro vector (Addgene, Watertown, MA, #62988) and described in our previous publication 45 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The shRNAs targeting HDAC1 (5′-CTATGGTCTCTACCGAAAA-3′) and HDAC3 (5′-GCATTGATGACCAGAGTTA-3′) were cloned into pLKO.1-TRC lentiviral vector (Addgene, #10878). For generation of lentivirus ...
-
bioRxiv - Cell Biology 2019Quote: ... non-targeting (5’-CCTAAGGTTAAGTCGCCCTCG-3’) and DDRGK1-targeting (5’-GGCTCTGCTAGTCGGCTTTAT-3’) shRNAs were cloned into pLKO.1 puro construct (Addgene #8453) according to protocol described in Addgene (https://www.addgene.org/tools/protocols/plko/?gclid=Cj0KCQiAm5viBRD4ARIsADGUT25ZCGNPeQSFvLqSwvg2tHDkCc9zOZsLdaUffZzNTRYzI_YOlKFVQdUaAqbfEALw_wcB)
-
bioRxiv - Biochemistry 2021Quote: ... shRNA targeting mSARM1 (5’-CCGGCTGGTTTCTTACTCTACGAATCTCGAGATTCGTAGAGTAAGAAACCAGTTTTTG-3’) or the scrambled shRNA (5’-CCGGCCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGGTTTTTG-3’) were inserted to pLKO.1-puro (Addgene, #8453) with EcoRI and AgeI ...
-
bioRxiv - Physiology 2023Quote: ... pAAV-GfaACC1D.Lck-GCaMP6f.SV40 (1.53×1013 vg/ml, working dilution 1:5, Addgene plasmid #52925-AAV5 ...
-
bioRxiv - Neuroscience 2021Quote: pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 (titer ≥ 1×1013 vg/ml, working dilution 1:5) was a gift from Douglas Kim (Addgene viral prep #100833-AAV9 ...
-
bioRxiv - Cell Biology 2020Quote: ... immortalized fibroblasts derived from the back skin of wildtype and LAP2α knockout littermates (Naetar et al., 2008) were transfected with the vector pSpCas9(BB)-2A-GFP (pX458, plasmid #48138 from Addgene, Watertown, MA) (Ran et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... sgRNA against exon 23 (Table 2) was cloned downstream of the U6 promoter of the pSpCas9(BB)-2A-GFP (PX458) plasmid (Addgene plasmid # 48138) 61 ...
-
bioRxiv - Molecular Biology 2019Quote: ... An online tool (crispr.mit.edu and Benchling) was used to design the gRNAs that were cloned into the plasmid Cas9(BB)-2A-GFP (Addgene plasmid 48138) as described previously7 ...
-
bioRxiv - Molecular Biology 2019Quote: ... was chosen to insert into the expression vector pX459 (pSpCas9{BB}-2A-Puro was a gift from Feng Zhang, Addgene plasmid # 48139). 24 hr after transfection ...
-
bioRxiv - Molecular Biology 2019Quote: ... sh3_MDC1 5’-GTCTCCCAGAAGACAGTGA-3’ cloned into pSUPERblast plasmid (Stewart et al, 2003) The pSpCas9(BB)-2A-puro plasmid (a generous gift from Dr. Feng Zhang, Addgene plasmid #62988) was used for CRISPR/Cas9 mediated knockout of SMCHD1.
-
bioRxiv - Genomics 2020Quote: The pCW-Cas9-2A-EGFP plasmid was constructed by replacing the FseI-BamHI fragment in the pCW-Cas9 plasmid (Addgene plasmid #50661) (21 ...
-
bioRxiv - Bioengineering 2020Quote: A pair of guide RNA targeting human EGFR was cloned into pSpCas9(BB)-2A-GFP (px458) plasmid vector (Addgene plasmid #48137) (Addgene, Cambridge, MA) following the depositor’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... double-stranded DNA sequences complementary to the target sequences were generated by PCR and then cloned into the pSpCas9(BB)-2A-GFP (PX458) vector (AddGene, cat. # 48138) (Table S1) ...
-
bioRxiv - Cancer Biology 2020Quote: ... The guided RNAs were cloned separately into the vector pSpCas9(BB)-2A-GFP (PX458) encoding for Cas9 and GFP (Addgene plasmid #48138). Sequences were as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... Fermentas) of annealed complementary oligonucleotides of the 20-nucleotides target sequences with the pSpCas9(BB)-2A-Puro (PX459) vector (Addgene plasmid #62988) digested with BbsI (BpilI ...
-
bioRxiv - Neuroscience 2020Quote: ... SgRNAs were cloned into the pSpCas9(BB)-2A-Puro plasmid containing the sgRNA scaffold and puromycine-resistance under the U6 promoter (Addgene plasmid #48139). Colonies that successfully integrated sgRNA into backbone plasmid were screened and confirmed by Sanger sequencing using U6 promoter region primer ...
-
bioRxiv - Cell Biology 2020Quote: ... Constructs for CRISPR/Cas9-mediated genome editing experiments expressing Cas9 and gRNAs were generated by cloning into pSpCas9(BB)-2A-Puro (PX459) vectors (Addgene plasmid #48139). Constructs were verified by Sanger sequencing.
-
Loss of TREM2 reduces hyperactivation of progranulin deficient microglia but not lysosomal pathologybioRxiv - Neuroscience 2021Quote: ... with 20 mg Cas9 (pSpCas9(BB)-2A-Puro (PX459) V2.0 (gift from Feng Zhang; Addgene plasmid #62988; http://n2t.net/addgene:62988; RRID: Addgene_62988 (Ran et al., 2013)) and 5 mg sgRNA cloned into the BsmBI restriction site of the MLM3636 plasmid (gift from Keith Joung ...
-
bioRxiv - Neuroscience 2020Quote: ... CRISPR guide RNA sequence (sgRNA#3 CTCAACACCATCTTCATCCG) targeting the human NLK locus was cloned into pSpCas9 (BB)-2A-GFP (Addgene #481387 PX458). Wild-type iPSCs were transfected with gRNA and Cas9-expressing plasmid using an Amaxa Nucleofector 2b and successfully transfected cells were collected by FACS ...
-
bioRxiv - Developmental Biology 2021Quote: The p133-pPB plasmids encoding for the Tal1-gRNAs were co-transfected with the pX458 plasmid containing a Cas9 nuclease construct and a GFP reporter (pSpCas9-2A-GFP, Addgene ID: 48138), kindly provided by Jamie Hackett from EMBL Rome ...