Labshake search
Citations for Addgene :
451 - 500 of 2778 citations for 6H 5 Oxa 1 2a 4a triazacyclopenta cd pentalene 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... These plasmids are based on all-in-one pSpCas9(BB)-2A-Puro (px459) (Addgene #62988) V2.0 and pSpCas9n(BB)-2A-Puro (px462 ...
-
bioRxiv - Cell Biology 2022Quote: ... and ligated into the BbsI site of pSpCas9(BB)-2A-Puro vector (PX459, Addgene #62988). U-2 OS cells were transfected with two PX459 encoding sgRNAs using lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... sgRNAs were cloned into the pSpCas9(BB)–2A–GFP (PX458) vector (Addgene plasmid #48138 46) or PX330-Puro (kind gift from Prof Ciaran Morrison ...
-
bioRxiv - Neuroscience 2020Quote: ... and were cloned into the pSpCas9(BB)-2A-Puro (PX459) V2.0 plasmid (Addgene plasmid 62988) according to a previously described protocol (Ran et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... We also generated knockout cells using pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene Plasmid #62988). Editing of the DPYSL2 locus in MDA-MB-231 cells was accomplished by either infecting cells with the “pLentiCRISPR” plasmid ...
-
bioRxiv - Genomics 2021Quote: sgRNA were cloned in pSpCas9(BB)-2A-Puro (PX459) V2.0 (Feng Zhang laboratory, Addgene 62988). Briefly ...
-
bioRxiv - Biochemistry 2020Quote: ... The guides RNAs were expressed from the plasmid pSpCas9(BB)-2A-GFP (pX458) (Addgene, #48138) (Ran et al. ...
-
Loss of TREM2 reduces hyperactivation of progranulin deficient microglia but not lysosomal pathologybioRxiv - Neuroscience 2021Quote: ... with 20 mg Cas9 (pSpCas9(BB)-2A-Puro (PX459) V2.0 (gift from Feng Zhang; Addgene plasmid #62988 ...
-
bioRxiv - Developmental Biology 2022Quote: ... The sgRNA/Cas9 plasmid was modified from SpCas9-2A-Puro V2.0 plasmid (Addgene, Feng Zang).
-
bioRxiv - Neuroscience 2023Quote: ... 6.25 μg of Cas9 expression vector (pCAG-1BPNLS-Cas9-1BPNLS-2A-GFP; Addgene, plasmid 87109) and 12.5 μg of donor plasmid using Lipofectamine LTX (Thermo ...
-
bioRxiv - Neuroscience 2022Quote: ... pXR001: EF1a-CasRX-2A-EGFP was a gift from Patrick Hsu (Addgene plasmid # 109049; RRID:Addgene_10904974). CasRX compatible guide RNA expression was achieved by cloning the guide sequences into the pXR003 vector backbone (pXR003 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Guide RNAs (gRNAs) were cloned into the pSpCas9n(BB)-2A-GFP (PX461) plasmid (Addgene #48140) and delivered to parental K562 cells by Amaxa nucleofection using the Amaxa Cell line nucleofector kit V (Lonza VCA-1003) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were transfected with the pCAG-eSpCas9-2A-GFP (generous gift from Jizhong Zou, Addgene plasmid #79145 ...
-
bioRxiv - Immunology 2024Quote: ... targeting mouse Pvrl2 or Pvr were cloned into pSpCas9(BB)-2A-GFP plasmid (PX458, ADDGENE). 6 μg of each vector was transfected into tumor cells plated on a 6-well plate using FuGENE6 transfection reagent (Promega ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR products were cloned into the doxycycline-inducible plasmid pCW57-MCS1-2A-MCS2 (Addgene #71782), which was modified by adding bGHpolyA between the MluI and BamHI restriction sites ...
-
bioRxiv - Genetics 2023Quote: ... sgRNAs were cloned individually into the plasmid pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene, #62988) and then transfected into XEN cells using XfectTM transfection reagent (Clontech ...
-
bioRxiv - Cancer Biology 2023Quote: pSpCas9(BB)-2A-GFP (px458) plasmid was a gift from Feng Zhang (Addgene plasmid #48138). The designated sgRNA sequences for each of the targeted genes were cloned into px458 using combinations of top and bottom oligonucleotides listed below.
-
bioRxiv - Neuroscience 2023Quote: ... pSpCas9(BB)-2A-Puro (PX459) V2.0 was a gift from Feng Zhang (Addgene plasmid # 62988) was modified to target the region of interest ...
-
bioRxiv - Neuroscience 2023Quote: Human iPSCs were edited using the pSpCas9(BB)-2A-GFP (PX458) construct backbone (Addgene #48138) described in Ran et al 201380 ...
-
bioRxiv - Genetics 2023Quote: ... The guide was cloned into the pSpCas9(BB)-2A-Puro (PX459) V2.0 plasmid (Addgene, #62988) via restriction digestion and ligation ...
-
bioRxiv - Cancer Biology 2023Quote: ... the Cas13d-NLS cassette was PCR-amplified from the pXR001_EF1a-CasRx-2A-EGFP (Addgene #109049) plasmid and cloned into pLX_TRC311-NLS-Cas13b-NES-P2A-Blast-eGFP ...
-
bioRxiv - Genetics 2019Quote: ... sgRNA plasmids targeting CDS close to the stop codon were GP07595 (Act5c) (Addgene #130278, DGRC #1492), GP07596 (His2Av) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pcDNA3.1_Signal-Flag-DRD2 was generated by PCR amplifying the DRD2 CDS from DRD2-Tango (Addgene #66269) (introducing a stop codon ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pcDNA3.1_Signal-Flag-HTR2A was generated by PCR amplifying the HTR2A CDS from HTR2A-Tango (Addgene #66409) (introducing a stop codon ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pcDNA3.1_Signal-Flag-ADRB2 was generated by PCR amplifying the ADRB2 CDS from ADRB2-Tango (Addgene #66220) (introducing a stop codon ...
-
bioRxiv - Bioengineering 2023Quote: ... the protein coding sequence (CDS) of RLuc8.6 was amplified from pcDNA-RLuc8.6-53559 (Addgene ID 87125) and subcloned into the vector pRSETb115 (Addgene ID 89536 ...
-
bioRxiv - Plant Biology 2024Quote: ... the CDS of AtCNIH5 was amplified by PCR and subcloned into UBQ10:sXVE: S10-(MCS) (Addgene plasmid # 108177 ...
-
bioRxiv - Molecular Biology 2020Quote: ... phosphorylated and cloned into the BbsI sites of the pSpCas9(BB)-2A-GFP (Addgene plasmid # 48138) (Ran et al ...
-
bioRxiv - Molecular Biology 2021Quote: ... and also cloned spCas9nuclease with Chd4 sgRNA based on PX458-pSpCas9(BB)-2A-GFP (#48138, Addgene). Then ...
-
bioRxiv - Cancer Biology 2019Quote: ... The CRISPR/Cas9 plasmid pSpCas9n(BB)-2A-Puro was a gift from Feng Zhang (Addgene #48141). Lentiviral vectors for GFP-FAK wildtype and FAK kinase-dead (R454 ...
-
bioRxiv - Neuroscience 2020Quote: ... an inverted bicistronic 2A sequence was inserted into pAAV-Ef1α-DIO-EGFP-WPRE-pA (Addgene#37084) upstream of EGFP by PCR linearization and overhang production on pAAV vector ...
-
bioRxiv - Neuroscience 2020Quote: ... These two gRNAs were then subcloned into pSpCas9n(BB)-2A-GFP plasmid (pX461; Addgene No: 48140). We made use of Cas9 nickase (Cas9n ...
-
bioRxiv - Cancer Biology 2020Quote: ... Appropriate guide RNAs were separately cloned into the SpCas9(BB)-2A-GFP (PX458) vector (Addgene, 48138) or pSpCas9(BB)-2A-Puro (PX459 ...
-
bioRxiv - Cancer Biology 2022Quote: ... the plasmid pSpCas9(BB)-2A-GFP (PX458) (PX458 was a gift from Feng Zhang, Addgene #48138) in which a sgRNA targeting either an intergenic region of chromosome 8 (Ctrl ...
-
bioRxiv - Genetics 2022Quote: ... Complementary gRNA oligonucleotides were cloned into pSpCas9(BB)-2A-Puro plasmid (pX459; Addgene plasmid ID# 48139) using the BbsI I site ...
-
bioRxiv - Molecular Biology 2020Quote: ... NLS-Cas13d-NLS-HA-T2A-GFP was amplified from pXR001: EF1a-CasRx-2A-EGFP (Addgene #109049) and recombined into pCR8-TOPO and then further recombined into pMK33-GW to generate pMK33/NLS-Cas13d-NLS-HA-T2A-GFP ...
-
bioRxiv - Cancer Biology 2019Quote: ... The sgRNAs were cloned into the pX459 (pSpCas9 (BB)-2A-Puro) plasmid vector (Addgene, Cat#62988). Mouse or human cell lines were transfected with the abovementioned plasmids using Lipofectamine 3000 ...
-
bioRxiv - Cell Biology 2019Quote: ... followed by PCR amplification and insertion of 2A-PuroR (a gift from Brett Stringer; Addgene 98290) and TagBFP ...
-
bioRxiv - Cell Biology 2021Quote: ... Single CYRI CRISPR A-673 was generated using Lentiviral CRISPR vector (hSpCas9-2A-Puro, Addgene #62988) and selected using 1μg/ml Puromycin (Invivogen ...
-
bioRxiv - Cell Biology 2019Quote: ... CSB or XPA gene together with an expression vector encoding Cas9-2A-GFP (pX458; Addgene #48138) using lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... and cloned into the BbsI site of pSpCas9(BB)-2A-GFP (pX458; Addgene, Cambridge, MA, USA). PX 458 was a gift from Feng Zhang (Addgene plasmid # 48138 ...
-
Optimized RNA-targeting CRISPR/Cas13d technology outperforms shRNA in identifying essential circRNAsbioRxiv - Molecular Biology 2020Quote: ... the cells were transduced by EF1a-CasRx (no NLS-RfxCas13d)-2A-EGFP (modified from Addgene #109049) lentivirus ...
-
bioRxiv - Molecular Biology 2022Quote: The RfxCas13d-GFP cassette was amplified from the plasmid pXR001:EF1a-CasRx-2A-EGFP (Addgene #109049) using the primers ...
-
bioRxiv - Cell Biology 2022Quote: ... Guide RNA oligos (GTAACGGCAGACTTCTCCTC) were ligated into the pSpCas9(BB)-2A-GFP (px458) vector (48138; Addgene). BEL-A cells (1.0 × 106 ...
-
bioRxiv - Cell Biology 2022Quote: ... GTCGTCGGCCCGCTTCCGGAAGG for RnArpC5 and GATCCACTCGGCGGAAGCGTGAGG for RnArpC5Lwere cloned into pSpCas9(BB)-2A-Puro (Addgene, ID 48139). Cells were transfected employing Lipofectamine™ LTX Reagent with PLUS™ Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... the sgRNA spacers were cloned into the pSpCas9(BB)-2A-Puro (PX459) V2.0 plasmid (Addgene #62988) as described previously (Ran et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... The pX459-sfCherry CRISPR-Cas9 vector were generated from pSpCas9(BB)-2A-Puro (pX459) V2.0 (Addgene plasmid # 62988 ...
-
bioRxiv - Genetics 2024Quote: ... Plasmid pCK002_U6-Sa-sgRNA(mod)_EFS-SaCas9-2A-Puro_WPRE was a gift from Aviv Regev (Addgene plasmid # 85452 ...
-
bioRxiv - Cell Biology 2024Quote: ... [34] for endogenous tagging and BbsI sites forpSpCas9(BB)-2A-Puro (PX459) V2.0 plasmid (Addgene 62988), for ATG14 knockouts ...
-
bioRxiv - Synthetic Biology 2023Quote: Plasmid pSpCas9(BB)-2A-Puro (PX459) V2.0 was a gift from Feng Zhang (Addgene plasmid #6298832), pU6-sgGFP-NT1 was a gift from Stanley Qi & Jonathan Weissman (Addgene plasmid #46914 ...