Labshake search
Citations for Addgene :
451 - 500 of 2123 citations for Mouse EGF Like Repeat And Discoidin I Like Domain Containing Protein 3 EDIL3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... for the Right Arm (5’-TACATCCCTAAGGCCTGATTACCCGAACACT-3’, 5’-TATACGCGTTGCCATGCTATTGGCTTC-3’) and cloned into pHD-DsRed-attp (Gratz et al., 2014; Addgene Plasmid # 51019) in two steps ...
-
bioRxiv - Cancer Biology 2019Quote: ... GDI2 (crGDI2-1 Fw 5’ GCCACCCGAGTCAATGGGGA 3’ and crGDI2-2 Fw 5’ CACTCTCTCCTCCGTACGTA 3’) into a lentiviral CAS9 expressing plasmid (Addgene Plasmid # 49535) using the BSMB1 restriction sites ...
-
bioRxiv - Cell Biology 2021Quote: ... human MCOLN1 was amplified by PCR with the following oligonucleotides with overhangs (underlined): 5’-GACACCGACTCTAGAATGGTGAGCAAGGGCGAGGAGC-3’ (forward) and 5’-AACTAGTCCGGATCCTCAATTCACCAGCAGCGAATGC-3’ (reverse) from Mucolipin1-pEGFP C3 (Addgene plasmid #62960) construct and subcloned into XbaI and BamHI restriction sites of pLenti-CMV-MCS-GFP-SV-puro (Addgene plasmid #73582 ...
-
bioRxiv - Cancer Biology 2020Quote: ... tag-containing MAP3K7 forward primer (5’-cagtGGGCCCaccATGTA CCCATACGATGTTCCAGATTACGCTAGCGGCCGCATGTCTACAGCCTCTGCCG-3’) and its reverse primer (5’-ATAggatccTCATGAAGTGCCTTGTCGTTTC-3’) were used to amplify MAP3K7 from pDONR223-MAP3K7 plasmid (Addgene plasmid #23693) and cloned into the NotI and BamHI sites of lentiviral vector pHIV-Zsgreen (Addgene plasmid #18121 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The sgRNA pairs were manually selected from the output list and cloned into the pGECKO backbone (CRISPRi.1: 5’ GTTACTTCCAACGTACCATG 3’, CRISPRi.2: 5’ CCTGTACCCCCATGGTACGT 3’) (Addgene 78534; (68))
-
bioRxiv - Cancer Biology 2021Quote: ... by introducing one or two guide RNAs (5′-GTTGGCTCGCCGGATACGGG-3′ for H3f3b; 5′-ACTCCAGTCTTTCTAGAAGA-3′ for Rosa26) into LentiCRISPR v2 (Addgene plasmid #52961) and LentiCRISPRv2 hygro (Addgene Plasmid #98291) ...
-
bioRxiv - Cell Biology 2022Quote: A sgRNA construct targeting exon 2 of the human ACLY gene was made by inserting annealed, phosphorylated oligonucleotides (5′-CACCGGAATCGGTTCAAGTATGCTC-3′, 5′-AAACGAGCATACTTGAACCGATTCC-3′) into pSpCas9(BB)-2A-Puro (PX459, Addgene, plasmid 48139). The sgRNA construct was then transfected (2 μg ...
-
bioRxiv - Systems Biology 2019Quote: ... we performed inverse PCR using F primer (5’-TGAGCGGCCGCTAGGTACCTTTAA-3’) and R primer (5’-GGCACCGGGCTTGCGGGTCATGCA-3’) and pKLV-U6gRNA-EF(BbsI)-PGKpuro2ABFP (Addgene, Plasmid #62348) as a template ...
-
bioRxiv - Microbiology 2020Quote: ... targeting ACE2 (5’-TGGATACATTTGGGCAAGTG −3’) and one targeting B4GALT7 (5’-TGACCTGCTCCCTCTCAACG-3’) was cloned into the lentiGuide-Puro plasmid (Addgene plasmid #52963) following published procedure (Sanjana et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... 5’- CGCGTCGACATGGTGAGCAAGGGCGAGGA-3’ and mCh REV: 5’-ACGCGGATCCCTTGTACAGCTCGTCCATGC-3’ and ligating it into pENTR4 no ccDB (gift from E. Campeau, Addgene plasmid #17424) plasmid (Campeau ...
-
bioRxiv - Developmental Biology 2021Quote: ... The fragment has been amplified using the primers F-5’-TGCAGGATCCCATCGATTCGGCCACCATGAAACGGACAG -3’ and R-5’-TAGAGGCTCGAGAGGCCTTGTCAGACTTTCCTCTTCTTCTTGG -3’) from the pCAG-CBE4max-SpG-P2A-EGFP plasmid (Addgene plasmid #139998)14 and from the pCAG-CBE4max-SpRY-P2A-EGFP plasmid (Addgene plasmid #139999)14.
-
bioRxiv - Genetics 2020Quote: ... oligonucleotides for gRNA synthesis (5’ TAGGAGGAAACTGTGCTCTTCA 3’ and 5’ AAACTGAAGAGCACAGTTTCCT 3’) were annealed and ligated into plasmid pDR274 (Addgene #44250, Watertown, MA). Purified plasmid DNA was digested with DraI (New England BioLabs ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5’-GCGCCTCCTGCGAAGCCATCAGG-3’ and 5’-CGTAGCGGGAAGGGTCAAGAGGG-3’) were similarly cloned into the lentiCRISPRv2-hygro vector (a gift from Brett Stringer, Addgene plasmid #98291)51.
-
bioRxiv - Molecular Biology 2022Quote: ... Single and double RNAi constructs targeting endogenous trap-1 and trap-3 were cloned by inserting the spliced coding sequences of trap-1 and trap-3 into vector L4440 (Addgene plasmid #1654). The constructs were then transformed into the RNAi feeding E ...
-
bioRxiv - Immunology 2023Quote: ... Next the LentiGuide-Puro plasmid [49] was used to express a single-guide RNA (CD58 sgRNA; 5’-GAGCATTACAACAGCCATCG-3’ and ICAM4 sgRNA: 5’-CCGGGAACACCTGCGTCACG-3’) LentiGuide-Puro (Addgene plasmid # 52963) was a gift from Feng Zhang ...
-
bioRxiv - Developmental Biology 2023Quote: ... sgRNAs 5’-CCCCATGGACATACCCACTG-3’ and 5’-CCAGTCGAGCAGAAAAGTGT-3’ defining a 244 bp region in Nodal exon 2 were cloned into pX458 (Addgene plasmid #48138) or pX459 (Addgene plasmid #48139 ...
-
bioRxiv - Genomics 2024Quote: ... 5’CTTCG-AATAGAATCGCCGCCCGCT3’;antisense:3’CTTATCTTAGCGGCGGGCGACAAA5’)and(se nse:5’CTTC-GTTGTGGCTGCACAGACTGG3’;antisense:3’CAACACCGACGTGTCTGACC-CAAA5’) into the pU6-BbsI-chiRNA plasmid (Addgene no. 45946), following the protocol outlined on the flyCRISPR website ...
-
bioRxiv - Molecular Biology 2020Quote: ... The BirA Ligase containing plasmid was purchased (Addgene #64395). The BirA Ligase was cloned in frame to the C/EBPα C-terminus using BamHI and XhoI restriction sites ...
-
bioRxiv - Synthetic Biology 2021Quote: ... coli S2060 cells were prepared containing pJC175e (Addgene #79219), a plasmid expressing pIII under control of the phage shock promoter32 ...
-
bioRxiv - Microbiology 2021Quote: ... The recombinant plasmid containing human ACE2 gene (Addgene #1786) was transfected into HEK293T cells using Lipofectamine 2000 Transfection Reagent (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2022Quote: ... plasmid containing full-length E6 and its pLentiN (RRID:Addgene_37444) vector backbone control were used to stably express E6 ...
-
bioRxiv - Genomics 2021Quote: ... coli containing pTXB1-3xFlag-pA-Tn5-FL (Addgene, #124601), a kind gift from (Kaya-Okur et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... The plasmid containing BDNF cDNA (pCMV6 BDNF, Addgene #39857) was a gift from Dr ...
-
bioRxiv - Plant Biology 2023Quote: ... backbones together with parts containing LucN (pEPYC0CM0133, Addgene #154595), a C-terminal 3×FLAG® epitope tag (pICSL50007 ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmid DNA containing desmosome genes were purchased from Addgene, [Dsc2a no ...
-
bioRxiv - Systems Biology 2023Quote: ... with 1000 ng plasmid containing inducible HGF (Addgene #188749) or a constitutive pEF1α-HGF (Addgene #188748 ...
-
bioRxiv - Neuroscience 2023Quote: Vectors containing the identified fluorophores obtained from Addgene (Addgene.com) were cloned into plasmids under the CMV promoter ...
-
bioRxiv - Cell Biology 2023Quote: ... wash buffer containing 500 nM SUMOEu1 protease (Addgene #149333) was added to the beads and left to incubate for 30 minutes with mixing at 4°C ...
-
bioRxiv - Synthetic Biology 2024Quote: A plasmid containing GCaMP6m was obtained from Addgene (36) and gblocks were obtained from IDT ...
-
bioRxiv - Bioengineering 2023Quote: ... Plasmid containing LSSmApple is available from AddGene (Plasmid #191259). LSSmApple spectral data have been uploaded to FPbase and are accessible at https://www.fpbase.org/protein/lssmapple/.
-
bioRxiv - Genetics 2020Quote: ... and 3’ sgRNAs were cloned into lenti_sgRNA_EFS_GFP (Addgene 65656) vector ...
-
bioRxiv - Neuroscience 2020Quote: [3] 5XQUAS from pQUAST-mCD8-GFP (Addgene plasmid #24351) (Primers ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were transfected with GFP-tagged galectin 3 (Addgene) or a mutant variant of it ...
-
bioRxiv - Biophysics 2020Quote: ... human 3’ HP1α-AID-sfGFP 2A PuroR (Addgene 127906) and a guide RNA/Cas9 plasmid pX330 human 3’ HP1α gRNA (Addgene 127907 ...
-
bioRxiv - Genetics 2022Quote: ... were cloned into pCFD4-U6:1-U6:3 (Addgene® plasmid #49411 ...
-
bioRxiv - Neuroscience 2021Quote: ... with sgRNA (5’-CTTGTGGGGTCA-TGGTTTACAGG-3’) plasmid (Addgene, 68463), Cas9 plasmid ...
-
bioRxiv - Bioengineering 2020Quote: ... melanogaster U6:3 promoter fragment sequence amplified from Addgene plasmid #49411 23 with primers 1045.C1 and 1045.C2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... human GFP-RBFOX2 (transcript variant 3) (Addgene, plasmid #63086) or empty vector (pcDNA 5 ...
-
bioRxiv - Neuroscience 2022Quote: ... 3) AAV1.hSyn.GCamP6s.WPRE.SV40 (6.67×1012 GC/kg, Addgene #100843). Before puncturing a capillary of interest ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 3 μg of plasmid VSVG (Plasmid #8454, Addgene). Cells were incubated at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 3 μg of plasmid VSVG (Plasmid #8454, Addgene) in a 10 cm dish ...
-
bioRxiv - Neuroscience 2021Quote: ... or KH1*KH2* mutants were PCR amplified from their respective pAc5.1B-EGFP vector and cloned into the HindIII and EcoRI sites of the pAc5.1-lambdaN-HA vector (a gift from Elisa Izaurralde; Addgene plasmid #21302) (Behm-Ansmant et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... was PCR amplified and cloned downstream of EGFP in the pAc5.1B-EGFP vector (a gift from Elisa Izaurralde; Addgene plasmid #21181) using the HindIII and EcoRI restriction sites to make pAcB5.1-EGFP-FMRP ...
-
bioRxiv - Cell Biology 2023Quote: ... and inserted into the back-to-back BsmB I restriction sites of lentiCRISPRv2 vector (#52961, Addgene). The sequence for each sgRNA is as follows ...
-
bioRxiv - Cell Biology 2023Quote: ... eGFP-4.1R was generated by using pTK81_GFP-4.1R (Again a gift from I. Cheeseman, Addgene #46352) and cloning into CMV-eGFP-C1 vector using XhoI and SacII cut sites.
-
Hippocampal efferents to retrosplenial cortex and lateral septum are required for memory acquisitionbioRxiv - Neuroscience 2020Quote: ... enhanced yellow fluorescent protein (eYFP) or enhanced green fluorescent protein (eGFP): AAV1.CaMKIIa.eNpHR3.0.eYFP.WPRE.hGH (Addgene, #26971), AAV1.CaMKII.eYFP ...
-
bioRxiv - Genomics 2019Quote: ... we cloned effector proteins (PguCas13b: Addgene 103861 ...
-
bioRxiv - Genetics 2019Quote: ... Cas9 protein and mRNA (44758; Addgene) were co-microinjected into zygotes [F1 hybrids between strains FVB/NJ and B6(Cg)-Tyrc-2J/J] using the reagent concentrations listed in Table S1 ...
-
bioRxiv - Bioengineering 2021Quote: ... the Spike protein (Addgene plasmid # 145032) was cloned downstream of the TRE3G promoter ...
-
bioRxiv - Bioengineering 2021Quote: ... We acquired psPAX2 encoding lentiviral packaging proteins and PMD2.G encoding a lentiviral envelop protein from Addgene (plasmid no ...