Labshake search
Citations for Addgene :
451 - 500 of 1451 citations for Recombinant Human PRMT5 Flag & His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... and the injections of AAV5-hSyn-NES-his-CaMPARI2-WPRE-SV40 (2.5x10^12gc/ml Addgene 200nl measured using a Nano Injector ...
-
bioRxiv - Molecular Biology 2021Quote: ... The HALO-tagged version of this plasmid was created by replacing eGFP with NGFR (Addgene plasmid 27489) using Gibson assembly (NEB) ...
-
bioRxiv - Neuroscience 2020Quote: ... GFP-tagged Gephyrin-FingR was a gift from Don Arnold (Addgene plasmid #46296 (Gross et al., 2013)) ...
-
bioRxiv - Neuroscience 2019Quote: ... the DNA cassette encoding KASH-tagged EGFP (EGFPKASH) (16) was amplified from the PX552 plasmid (Addgene #60958) by Phusion High-Fidelity DNA polymerase ...
-
bioRxiv - Cell Biology 2020Quote: ... pcDNA3.1-Flag-CLASPIN was a gift from Michele Pagano (Addgene plasmid #12659). Primers containing restriction sites were used to amplify cDNAs for subcloning and primers with mutations or deletions were used for site-directed mutagenesis (SDM) ...
-
bioRxiv - Developmental Biology 2021Quote: ... using the linearized plasmid pST1374-NLS-flag-linker-Cas9 (Addgene 44758 45) as a template ...
-
bioRxiv - Cancer Biology 2020Quote: The HA-FLAG-hKDM5A.dn3 (#1048) was a gift from William Kaelin (Addgene plasmid # 14799 ...
-
bioRxiv - Biochemistry 2021Quote: ... pLPC-puro-N-Flag was a gift from Titia de Lange (Addgene plasmid # 12521 ...
-
bioRxiv - Cell Biology 2021Quote: ... pEGFP-C1-FLAG-Ku80 (Addgene #46958, gift from Dr. S. Jackson, (26)) ...
-
bioRxiv - Genomics 2020Quote: ... The pCMV-FLAG LAP2 plasmid was a gift from Joan Massague (Addgene plasmid #15738 ...
-
bioRxiv - Cancer Biology 2021Quote: ... HEK 293FT cells were transfected with pRK5-TGFβRI-FLAG plasmid (Addgene, #14833) using Lipofectamine 3000 transfection kit ...
-
bioRxiv - Biochemistry 2021Quote: The FLAG-HSF-1 plasmid was purchased from Addgene (ID 32537, RRID:Addgene_32537), which was originally established by Dr Stuart Calderwood (40) ...
-
bioRxiv - Biochemistry 2021Quote: ... The pcDNA3 Flag HA plasmid was purchased from Addgene (ID 10792, RRID:Addgene_10792), which was originally established by Dr William Sellers ...
-
bioRxiv - Molecular Biology 2020Quote: Protein expression constructs were obtained through the following: FLAG-N1ICD (AddGene #20183), N2ICD (#20184) ...
-
bioRxiv - Cell Biology 2022Quote: ... pRK5-FLAG-LAMTOR2 was a gift from David Sabatini (Addgene plasmid # 42330) (Bar-Peled et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... the YTHDF2 ORF was PCR amplified from pcDNA-flag-YTHDF2 (Addgene, #52300). The resulting amplicon was digested with AgeI and XbaI and cloned into cut sites upstream of HaloTag insert in pGW1-Halo.
-
bioRxiv - Neuroscience 2022Quote: ... the YTHDF2 ORF was PCR amplified from pcDNA-flag-YTHDF2 (Addgene, #52300). The resulting amplicon was digested with KpnI and SalI and cloned into cut sites upstream of the 2A in the pGW1-2A-GFP vector.
-
bioRxiv - Molecular Biology 2023Quote: FLAG-TAL1-short/long were cloned to MIGR1 vector (Addgene, plasmid#27490). HEK293T cells were co-transfected with the viral backbone vector pCMV-VSVG and pCL-Eco packaging vectors using polyethylenimine (PEI ...
-
bioRxiv - Cell Biology 2023Quote: ... and Flag Snai1 6SA (Addgene plasmid #16221; http://n2t.net/addgene:16221; RRID:Addgene_16221), plasmid pDONR223_NOTCH1_ICN (Addgene plasmid #82087 ...
-
bioRxiv - Cancer Biology 2023Quote: ... FLAG-β-catenin plasmid constructs were purchased from Addgene (FLAG-β-catenin WT (Addgene plasmid #16828; http://n2t.net/addgene:16828; RRID:Addgene_16828), FLAG-β-catenin K49R (Addgene plasmid # 44750 ...
-
bioRxiv - Cancer Biology 2023Quote: ... FLAG-β-catenin K49R (Addgene plasmid # 44750; http://n2t.net/addgene:44750; RRID:Addgene_44750), FLAG-β-catenin K19R (Plasmid #Addgene plasmid # 44749 ...
-
bioRxiv - Cell Biology 2023Quote: ... and pUbC-FLAG-24xSuntagV4-oxEBFP-AID-baUTR1-24xMS2V5-Wpre (Addgene plasmid # 84561) were gifts from Dr ...
-
bioRxiv - Cancer Biology 2023Quote: ... GFP-P65 reporter (#127172) and Flag-KEAP1 (#28023) plasmids were from Addgene. NL3.2.NF-ΚB-RE (#N1111 ...
-
bioRxiv - Developmental Biology 2023Quote: The mouse Runx1 overexpression plasmid pCDNA3.1-Flag-Runx1 was purchased from Addgene. The mouse Runx2 plasmid pCMV-Flag-mRunx2 was purchased from Origene ...
-
bioRxiv - Molecular Biology 2023Quote: ... VHL-NbGFP4-FLAG sequence was subsequently cloned into TLCV2 lentivector (Addgene #8736027) by PCR using Age I/Nhe I sites ...
-
bioRxiv - Microbiology 2023Quote: ... pCMV-Tag2b-Flag-NLRC5 (Addgene plasmid #37521; http://n2t.net/addgene:37521; RRID:Addgene_37521), pcDNA3.1-3xmyc-B-NLRC5 (Addgene plasmid #37509 ...
-
bioRxiv - Cell Biology 2023Quote: p4489 Flag-βTRCP was a gift from Peter Howley (Addgene plasmid # 10865) (Zhou et al ...
-
bioRxiv - Neuroscience 2023Quote: ... The desired region of plasmid pCMV6-XL4 FLAG-NGRN-Fc (Addgene #115773) was amplified by PCR ...
-
bioRxiv - Cell Biology 2024Quote: ... pGEX6P1-DEST-FLAG was a gift from Andrew Jackson & Martin Reijns (Addgene plasmid # 119754 ...
-
bioRxiv - Biophysics 2022Quote: Recombinant MBP-FUS construct was kindly gifted by Nicolas Fawzi (Addgene plasmid #98651) and was expressed in BL21 (DE3 ...
-
bioRxiv - Physiology 2019Quote: ... as were plasmids for recombinant production of PGC-1α (Addgene #1028 and 1029) (Puigserver et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... Recombinant lentiviral particles were produced using a protocol provided by the manufacturer (Addgene). In brief ...
-
MANF regulates unfolded protein response and neuronal survival through its ER-located receptor IRE1αbioRxiv - Cell Biology 2020Quote: ... pEZYflag and pEZYmyc-His were a gift from Yu-Zhu Zhang (Addgene plasmids #18700 and #18701). Gateway destination vectors for BiFC for N- and C-terminal tagging with Venus fluorescent protein fragments (pEZY BiFC N NV ...
-
bioRxiv - Biochemistry 2021Quote: ... The His-Sumo bacterial version was codon optimized and cloned into K27-Sumo (Addgene ID 169193) via NEBuilder HiFi DNA Assembly Cloning Kit (NEB) ...
-
bioRxiv - Cell Biology 2021Quote: ... His-Strep2-tag from 438-SNAP-V3 vector a gift from Scott Gradia (Addgene plasmid # 55223) with inserting CATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCAT sequence right in front of Strep II gene by PCR primer ...
-
bioRxiv - Biochemistry 2020Quote: MBP-hnRNPA2 LC, soluble His-tag purification as described (Ryan et al., 2018) (Addgene ID: 98661)
-
bioRxiv - Cancer Biology 2023Quote: SULF2 ORF including C-terminal Myc-His tag was subcloned from its source vector (Addgene # 13003) to lentiviral transfer vector pHR-CMV-TetO2_3C-Twin-Strep (Addgene # 113883 ...
-
bioRxiv - Cell Biology 2022Quote: ... mRFP-GFP tandem fluorescent-tagged LC3 (tfLC3) was a gift from Tamotsu Yoshimori (Addgene plasmid # 21074; www.addgene.org/21074)51 ...
-
bioRxiv - Microbiology 2019Quote: ... C57BL/6 MEFs were transfected with GFP- or HA-epitope tagged ubiquitin plasmids (Addgene #11928 and #18712, respectively) 24 hours before infection ...
-
bioRxiv - Cancer Biology 2020Quote: The lentiviral construct containing a truncated version of 53BP1 tagged with mApple was a gift from Ralph Weissleder (Addgene plasmid # 69531; http://n2t.net/addgene:69531; RRID:Addgene_69531)) ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLV-ER GFP encoding GFP tagged SEC61β was a gift from Pantelis Tsoulfas (Addgene plasmid #80069; http://n2t.net/addgene:80069; RRID:Addgene_80069), mEmerald-Rab11a-7 was a gift from Michael Davidson (Addgene plasmid #54245 ...
-
bioRxiv - Cancer Biology 2020Quote: The vector for V5-tagged active WNT11 was a gift from Xi He (Addgene plasmid #43824; http://n2t.net/addgene:43824; RRID:Addgene_43824)23 ...
-
bioRxiv - Immunology 2021Quote: ... Monomeric MBP-tagged NLRP3NACHT-LRR (aa 134-1034) was subcloned into pLenti CMVie-IRES-BlastR (Addgene plasmid #119863) with addition of N-terminal FLAG-tag ...
-
bioRxiv - Microbiology 2024Quote: ... and 125 ng of FLAG-tagged Med26 (a gift from Joan Conaway and Ronald Conaway [Addgene plasmid #15367; http://n2t.net/addgene:15367; RRID:Addgene_15367)(59)] expression vectors ...
-
bioRxiv - Developmental Biology 2021Quote: ... GST-human β-catenin (Addgene #24193), and NLS-mCherry (Addgene #49313 ...
-
bioRxiv - Molecular Biology 2022Quote: ... pscALPSpuro-HsACE2 (human) (Addgene, MA, USA) were co-transfected with psPAX2 and pCMV-VSV-G packaging plasmids into HEK293T cells using FuGENE 6 (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... human a-SYN (A53T mutant) (Addgene), and mt-Keima (Addgene) ...
-
bioRxiv - Cancer Biology 2024Quote: ORF encoding human MARK2 (Addgene, 23404) was cloned into pFL system with an N-terminal Strep2SUMO tag ...
-
bioRxiv - Cell Biology 2019Quote: Rab39b cDNA was cloned using Gibson Assembly into pEGF-N1-Flag plasmid (Addgene #60360 ...
-
bioRxiv - Physiology 2019Quote: ... pLKO-puro FLAG SREBP1 was a gift from David Sabatini (Addgene plasmid # 32017). PPRE-X3-TK-luc was a gift from Bruce Spiegelman (Addgene plasmid # 1015) ...