Labshake search
Citations for Addgene :
451 - 500 of 913 citations for DNA Mismatch Repair Protein Msh3 MSH3 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... 238 μg rep-cap plasmid encoding AAV5 capsid proteins (pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964 ; http://n2t.net/addgene:104964 ; RRID:Addgene_104964) and 64.6 μg of either the CalEx plasmid (pZac2.1-GfaABC1D-HA-hPMCA2w/b ...
-
bioRxiv - Cell Biology 2021Quote: ... The mCh-hRab7A (#922) plasmid encoding mCherry-labeled version of human Rab7A protein was from Addgene (Cat# 61804). GFP-hRab5A.dn3 (#966) ...
-
bioRxiv - Cell Biology 2021Quote: The RFP-hRab5A.dn3 (#921) plasmid encoding RFP-labeled version of human Rab5A protein was from Addgene (Cat# 14437). The mCh-hRab7A (#922 ...
-
bioRxiv - Immunology 2020Quote: ... pGBW-m4134096 encoding for SARS-CoV-2 M protein was a gift from Ginkgo Bioworks (Addgene plasmid #152039).
-
bioRxiv - Biochemistry 2023Quote: ... as described in Janecek et al.39 Aurora B protein was expressed from plasmid pNIC28-AurB (Addgene 39119).
-
bioRxiv - Cancer Biology 2024Quote: Plasmids for expression of lipid anchored fluorescent proteins were obtained from the Addgene repository: MyrPalm-CFP (Addgene #14867) and MyrPalm-GFP (#21037) ...
-
bioRxiv - Physiology 2022Quote: ... promoter and upstream of a P2A linker followed by the tdTomato fluorescent protein (gift from Kazuhiro Oka;Addgene plasmid # 72486; http://n2t.net/addgene:72486; RRID:Addgene_72486). To obtain a >98% transduced population ...
-
bioRxiv - Developmental Biology 2024Quote: ... or pCAG-DeAct-SpvB (a fusion protein of DeAct-SpvB with EGFP, subcloned into pCAG from Addgene #89446) plasmids to 3.5 µg/µL in molecular grade ddH2O with 5% sucrose and 0.1% Fast Green FCF ...
-
bioRxiv - Developmental Biology 2023Quote: ... The protein coding sequence of Lck-GFP was amplified from the Lck-GFP plasmid (Catalog no.61099, Addgene) using Phusion high fidelity polymerase (Catalog no ...
-
bioRxiv - Cell Biology 2024Quote: ... We next used the human EZH2 primary protein sequence available in the addgene for hEZH2 plasmid (#24230, Addgene) and predicted the possible cysteine residues using the GPS-SNO prediction tools ...
-
bioRxiv - Cell Biology 2024Quote: ... For G3BP1 live imaging a GFP-G3BP1 fusion protein containing plasmid (pEGFP-C1-G3BP1-WT, Addgene plasmid # 135997) was transfected with Lipofectamine™ 3000 Transfection Reagent (Invitrogen) ...
-
bioRxiv - Neuroscience 2023Quote: ... expressing the genetically encoded calcium indicator GCaMP6f under control of the calcium/calmodulin-dependent protein kinase (CaMKII) promoter (pENN.AAV5.CAMKII.GCaMP6f.WPRE.SV40, Addgene, Watertown, MA). Virus (0.5 µl ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmid pET28HIS-hAPE1 (for WT His-APE1 protein) was a gift from Primo Schaer (Addgene plasmid #70757; http://n2t.net/addgene:70757; RRID:Addgene_70757) (69) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Plasmid pcDNA3-YFP (for YFP protein) was a gift from Doug Golenbock (Addgene plasmid #13033; http://n2t.net/addgene:13033; RRID:Addgene_13033). Plasmid pcDNA3-YFP-APE1 (for WT YFP-APE1 protein ...
-
bioRxiv - Microbiology 2022Quote: ... The lentiviral vector plasmid pSICO-CPSF6-mNeonGreen encoding CPSF6 fluorescent fusion protein was a gift from Zandrea Ambrose (Addgene plasmid # 167585 ; http://n2t.net/addgene:167585 ; RRID:Addgene_167585).
-
bioRxiv - Cell Biology 2022Quote: ... promoter and upstream of a P2A linker followed by the tdTomato fluorescent protein (gift from Kazuhiro Oka;Addgene plasmid #72486; http://n2t.net/addgene:72486;RRID:Addgene_72486). To obtain a >98% transduced population ...
-
bioRxiv - Neuroscience 2023Quote: ... were used for the fusion protein and then inserted in rAAA-FLEX-axonGCaMP6s-P2A-mRUBY3 vector (#112008, Addgene) used as a backbone after excising axonGCaMP6s by BamHΙ and NheΙ ...
-
bioRxiv - Neuroscience 2024Quote: ... the coding sequence of the chimeric protein unc84:2xGFP17 was isolated from the original pMUH_unc84_2XGFP plasmid (Addgene #46023) via PCR using the following primers (5’-AACAGATCTGCGGCGGCAAAATGGCTCCCGCAACGGAAG-3’ and 5’-CGGCCCCTAGGGCGGTCACACCACAGAAGTAAGG-3’) ...
-
bioRxiv - Biochemistry 2024Quote: ... His6-tagged proteins were cleaved with TEV protease (expressed and purified in-house from plasmid pRK793 (Addgene #8827)) 29 then passed over a HisTrap HP column (Cytiva ...
-
bioRxiv - Neuroscience 2021Quote: ... the DNA plasmids were respectively derived from the plasmids pAAV:EF1α:DIO:ChETA-eYFP (plasmid #26968; Addgene, Watertown, MA, USA) and pAAV:EF1α:DIO:eYFP (Addgene plasmid #27056 ...
-
bioRxiv - Cell Biology 2022Quote: ... WT and FIP200 KO HeLa cells were cotransfected with the DNA fragment and the PX459 (Addgene #48139)-based plasmid expressing Cas9 and gRNA (GTCTTAGAAGCCGTGAGGTA for the NCOA4 gene ...
-
bioRxiv - Genomics 2020Quote: ... The resulting DNA fragments were cloned into the linearized STARR-seq vector (Addgene #71509, AgeI-SalI digested) using the In-Fusion HD kit (Takara) ...
-
bioRxiv - Cell Biology 2020Quote: ... plasmid as template DNA and primer ZU6_F1 and ZU6_Nanos3gRNA(NheI)_R with pDestTol2pA2-U6:gRNA (Addgene # 63157) plasmid as template DNA respectively.
-
bioRxiv - Neuroscience 2021Quote: ... WT and mutant forms of syt1 DNA were subcloned into a FUGW transfer plasmid (Addgene plasmid # 14883) modified with a synapsin promoter and an IRES-expressed soluble GFP marker ...
-
bioRxiv - Microbiology 2021Quote: ... marinum genomic DNA and cloned in-frame into the SspI site of 6XHis-MBP-TEV (AddGene: 29656). Plasmids were freshly transformed into the E ...
-
bioRxiv - Molecular Biology 2022Quote: ... The resulting DNA fragment containing two MpU6promoter-gRNA cassettes was transferred into pMpGE010 (cat. no. 71536, Addgene) (Sugano et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... a FoxO1 plasmid encoding a deleted DNA binding domain (amino acid 208-220) was used (Addgene #10694). After 24 hours ...
-
bioRxiv - Bioengineering 2023Quote: ... The amplified gRNA plasmid DNA was co-transfected into HEK 293T cells with psPAX2 (Addgene, plasmid #12260) and pMD2.G (Addgene ...
-
bioRxiv - Developmental Biology 2023Quote: DNA fragments coding for full-length human Deltex1 (1863bps) was inserted into the pcDNA3.1-HA (Addgene #128034) mammalian expression vector with an N-terminal HA tag ...
-
bioRxiv - Biochemistry 2023Quote: ... DNA oligos containing guide RNA (gRNA) sequences were cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene, #42230). The oligos were phosphorylated with T4 PNK (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... and the synthesised DNA fragments were subcloned into the BbsI sites of the pX459 vector (#62988, Addgene). The resulting constructs were transfected into ES cells using Lipofectamine 3000 (Life Technologies ...
-
bioRxiv - Biophysics 2023Quote: ... The DNA fragment encoding heteronu-clear ribonucleoprotein A1 (hnRNPA1) was amplified from pET9d-hnRNP-A1 (#23026, Addgene) using PCR and inserted into mCherry-C1 (pmCherry-hnRNPA1) ...
-
bioRxiv - Cell Biology 2023Quote: ... Transfection was performed using 1100 ng of total DNA (500 ng transfer plasmid, 500 ng pCMVR8.74 Addgene plasmid # 22036 ...
-
bioRxiv - Cancer Biology 2023Quote: ... EF.deltaBHES1.Ubc.GFP (DBD-HES1 DNA-binding domain mutant of HES1; #24982) were obtained from Addgene (Cambridge, USA). The reporter plasmids containing the firefly luciferase gene under the control of various fragments of the Hes1 promoter (2.5 kb ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 1.4 µg of DRD1-TANGO or DRD5-TANGO plasmid DNA (Plasmids #66268 or #66272, Addgene, Watertown, MA) and 120 µM CaCl2 (diluted with H2O from 2 mM stock ...
-
bioRxiv - Cell Biology 2024Quote: GFP11 and GFP11×7 plasmids from DNA preparation step in the appropriate reading frame (RRID: Addgene_172068, Addgene_172067). Ten-m is found is phase 1 thus it is possible to use the AddGene plasmids for GFP11 insertions ...
-
bioRxiv - Molecular Biology 2024Quote: ... Lentiviral particles were generated by co-transfecting 1.5 µg of total DNA of pMDLg/pRRE (Addgene #12251), pCMV-VSV-G (Addgene #8454) ...
-
bioRxiv - Cell Biology 2024Quote: GFP11 and GFP11×7 plasmids from DNA preparation step in the appropriate reading frame (RRID: Addgene_172068, Addgene_172067). Ten-m is found is phase 1 thus it is possible to use the AddGene plasmids for GFP11 insertions ...
-
bioRxiv - Neuroscience 2024Quote: Plasmid DNA used in this study included pMO91_human-STIM1-YFP (Addgene, ref# 19754; Prakriya et al., 2006), pEX-YFP-STIM1-deltaK (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... Plasmid containing dLight viral DNA (pAAV-CAG-dLight1.3b) was purchased from Addgene (#125560; Patriarchi et al., 2018) and packaged by the University of Minnesota’s Viral Vector and Cloning Core with a titer of ~1x1013 GC/ml (AAV5-CAG-dLight1.3b) ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV-CAG-fDIO-mKate2-2a-N2cG was generated by HIFI DNA assembly of mKate2 (from Addgene #159928), T2A and N2cG ORFs (from Addgene #73481 ...
-
bioRxiv - Cell Biology 2024Quote: ... The GPX4 genomic DNA fragments were cloned into pLJM1 (Addgene plasmid # 19319; http://n2t.net/addgene:19319; RRID:Addgene_19319) and confirmed via sequencing ...
-
bioRxiv - Cell Biology 2024Quote: ... a total of 3.65 μg DNA vectors including 0.47 μg pCE-hOCT3/4 (Addgene, MA, U.S.A, #41813), 0.47 μg pCE-hSK (Addgene ...
-
bioRxiv - Microbiology 2020Quote: ... The plasmid used for constructing recombinant virus was pVSVΔG-eGFP (where eGFP is enhanced green fluorescent protein; plasmid 31842; Addgene). GPC was cloned into the ΔG site ...
-
bioRxiv - Cell Biology 2020Quote: ... and WD repeat domain phosphoinositide-interacting protein 1 (WIPI1) cDNA was a gift from Noboru Mizushima (Addgene plasmid # 38272) (Itakura & Mizushima ...
-
bioRxiv - Immunology 2022Quote: ... To subclone the fusion protein constructs GFPNKG2D-S/L into the retroviral stem cell vector pMIGR1 (Addgene, plasmid 27490), forward 5’ TAGTAGGAATTCGCCACCATGAGCGGGGGCGAGGAC 3’ and the reverse 5’ TAGAGGTCGACCTTACACCGCCCTTTTCATGCAG3’ primers were used ...
-
bioRxiv - Neuroscience 2021Quote: ... The plasmids for expression of zinc finger fusion-proteins were newly generated based on the following cDNAs: pMT2 CaVβ1b GFP (gift from Annette Dolphin obtained through Addgene, plasmid # 89893 ...
-
bioRxiv - Immunology 2021Quote: ... and a plasmid encoding the spike protein (with a C-terminal truncation) from either SARS-CoV (Addgene cat 170447), SARS-CoV-2 53 ...
-
bioRxiv - Biochemistry 2020Quote: The cDNAs for protein expression in this study were as follows: DCLK1 (Transomic, BC133685) and Lambda phosphatase (Addgene, 79748). DCLK1 proteins were cloned in frame using Gibson cloning into a pET28 vector with an N-terminal strepII-Tag and a superfolder GFP (sfGFP ...
-
bioRxiv - Microbiology 2020Quote: ... The plasmids encoding the Spike protein were a mixture of (10 µg) of pcDNA3.1-SARS2-Spike (Addgene plasmid 145032) and (3 µg ...