Labshake search
Citations for Addgene :
301 - 350 of 913 citations for DNA Mismatch Repair Protein Msh3 MSH3 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... and the fluorescent protein cDNA for tagBFP was cloned from pdCas9::BFP-humanized (Addgene, #44247). A zebra finch FoxP2 cDNA clone provided by Erich Jarvis was subcloned into pLenti6.4 using a gateway reaction ...
-
bioRxiv - Biophysics 2020Quote: ... final protein expression constructs were generated by Gateway LR recombination into pDest-566 (Addgene #11517), an Escherichia coli T7–based expression vector based on pET42 and incorporating hexa-histidine (His6 ...
-
bioRxiv - Biophysics 2022Quote: ... pET19b:EcMscLGFP was used previously as an in vitro membrane protein folding reporter (Addgene plasmid # 165097) (Jacobs et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... Expression constructs for various cytoskeleton or organelle marker proteins were obtained from Addgene (S1 Table). For bacterial expression of His6-tagged CAHS proteins ...
-
bioRxiv - Cell Biology 2021Quote: MSCs were transduced with lentiviral particles having mitochondria targeting protein and GFP in downstream (Addgene) and lysosome were stained with lysotracker Deep-Red (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: HEK293T cells were transfected with an inducible nuclear-localized HT protein (HT-NLS, Addgene #82518). Doxycycline (DOX ...
-
bioRxiv - Neuroscience 2021Quote: ... enhanced yellow fluorescent protein (eYFP) or the single guide RNA (sgRNA) that cleaves KV3.4/KCNC4: pENN.AAV.CAG.tdTomato.WPRE.SV40 (Addgene #105554), pAAV.CamKII(1.3).eYFP.WPRE.hGH (Addgene #10522) ...
-
bioRxiv - Cell Biology 2020Quote: ... or a fluorescent protein (pCDNA3-GFP; Addgene plasmid #74165 or mCherry2-N1; Addgene plasmid #54517) was used to transfect HEK-293 cells at 70-90% confluency using Lipofectamine 3000 reagent (Thermo Fisher Scientific ...
-
bioRxiv - Synthetic Biology 2020Quote: The extracellular domain of ASLV-A envelope protein from the plasmid pAAV-TRE-HTG (Addgene) and the targeting domain encoding the Gbp6 nanobody33 were combined by PCR and cloned into a Piggybac transfer vector under a synthetic constitutive promoter (Supplementary Table 1) ...
-
bioRxiv - Immunology 2022Quote: MSP2N2-His6 protein (45) was expressed by transforming BL21 DE2 cells with pET28-MSP2N2 (Addgene). Cells were grown to a OD600 of ~0.8 in the presence of 50 μg/mL of kanamycin and induced for 3 hours with 0.5 mM isopropy β-D-1-thiogalactopyranoside (IPTG) ...
-
bioRxiv - Microbiology 2022Quote: ... to co-transfect plasmids containing cDNAs for SARS-CoV-2 E protein (pGBW-m4133502, Addgene) and green fluorescent protein (GFP ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmid pET28HIS-hAPE1 (for WT His-APE1 protein) was a gift from Primo Schaer (Addgene plasmid #70757 ...
-
bioRxiv - Cell Biology 2023Quote: ... a vector expressing dCas9-VP64 fusion protein based on pCMV-SpdCas9-VP64 (Addgene plasmid # 115794), a gift from Nadav Ahituv 62 ...
-
bioRxiv - Microbiology 2023Quote: HEK293 cells expressing transiently-transfected actin fused to monomeric azure-fluorescent protein (mAzure-Actin; Addgene) were grown on coverslips in 12-well plates at 2×105 cells/well and infected with Bp340 ...
-
bioRxiv - Neuroscience 2023Quote: ... Chimeric G proteins for the Gsx assay 44 were obtained from Addgene (Watertown, MA, USA).
-
bioRxiv - Molecular Biology 2023Quote: ... or Wnt7a-BioID2 fusion proteins were generated using the mycBioID2-pBABE-puro vector (Addgene Plasmid). Myoblasts were grown in 15 cm culture dishes at sub confluency and incubated with biotin (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2023Quote: TIA1 proteins were expressed in the BL21DE3 bacterial cell line from the pET28b plasmid (Addgene) containing the Mus musculus (mouse ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.85 μg pVSV-G (Expresses VSV-G envelop protein for pseudotyping NanoMEDIC particle, Addgene #138479) (46) ...
-
bioRxiv - Neuroscience 2023Quote: ... USA) and [2] a Cre-dependent virus expressing green fluorescent protein (AAV-Flex-GFP; Addgene) or diphteria toxin (AAV2/9-EF1a-mCherry-Flex-dTA ...
-
bioRxiv - Cell Biology 2023Quote: ... Both GFP11-tagged Fluc proteins and GEM transcriptional factor (cloned from pJW1663, Addgene plasmid #112037) were stably integrated into yeast genome ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... The dsRNA for Green fluorescent protein (GFP) was synthesised from plasmid pAC5.1B-EGFP (Addgene 21181) to be used as a negative control for off-target effects of dsRNA-mediated knockdown.
-
bioRxiv - Developmental Biology 2024Quote: ... we utilized monomeric enhanced green fluorescent protein (mEGFP) (gift from Karel Svoboda, Addgene plasmid #18696) (Harvey ...
-
bioRxiv - Neuroscience 2024Quote: ... a red fluorescent calcium sensor protein (RCaMP) was amplified from pAAV.Syn.Flex.NES-jRGECO1a.WPRE.SV40 (Addgene cat#100853) using primers 5’-ACTAGTATGCTGCAGAACGAGCTTGC and ACCGGTCTACTAGTCTCAATTGTCACTTCGCTGTCATCATTTGT ...
-
bioRxiv - Biochemistry 2024Quote: ... The tag-free wildtype (Wuhan-hu-1) nucleocapsid protein plasmid was purchased from Addgene (#177937), and the plasmid encoding the Strep-tagged nucleocapsid protein was a kind gift from Dr ...
-
bioRxiv - Cell Biology 2024Quote: ... We purchased the plasmid expressing an ER-localized hook protein from Addgene (Ii-Str_Neomycin; #65308). To generate various model substates with artificial CAT-tails ...
-
bioRxiv - Molecular Biology 2021Quote: ... a DNA fragment containing 5′-AGCCATGGGAAACATCGCAC-3′ was cloned into pL-CRISPR.EFS.tRFP (Addgene#57819) (Heckl et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... the cassettes were cloned via NEBuilder® HiFi DNA Assembly into AAVS1_SA_2A_Neo_CAG_RTTA3 (Addgene, #60431) (Sim et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA fragment of mito-mNep2-FLAG (mNeptune2-N1, a gift from Michael Davidson (Addgene plasmid # 54837 ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA fragment of mito-EmGFP and PGK promoter (a gift from Tyler Jacks (Addgene plasmid # 11586 ...
-
bioRxiv - Developmental Biology 2022Quote: DNA constructs reported in this study are available from Addgene (plasmid ID: 176836-176841). Genetically modified cells used in this study will be available from the corresponding author with an MTA ...
-
bioRxiv - Genomics 2020Quote: ... sgRNA cassettes were synthesized (Integrated DNA Technologies) and cloned into lentiGuide-Puro (Addgene, 52963) vector ...
-
bioRxiv - Biophysics 2021Quote: ... with 1 μg of DNA plasmid vector Cry2Olig-mCherry (purchased from Addgene, number 60032), and then platted on fluorodishes ...
-
bioRxiv - Cell Biology 2021Quote: ... Oligo DNAs for the sgRNA were cloned into the lentiCRISPRv2 (Addgene Plasmid: no. 52961) vector or pX459 (Addgene Plasmid ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and electroporated with the linear library DNA as well as the SS9_RNA (Addgene #71656) vector containing the guide RNA for Cas9 to target the safe harbor ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 million cells were nucleofected with iμg pAAV-CAG-GFP plasmid DNA (Addgene 37825) in Ingenio electroporation buffer (Mirus MIR50111 ...
-
Role of the Topoisomerase IIα Chromatin Tether domain in Nucleosome Binding & Chromosome SegregationbioRxiv - Cell Biology 2021Quote: ... The synthesized oligo DNA primers for the guides were inserted into pX330 (Addgene #42230). For Tet-inducible expression of exogenous TopoII ...
-
bioRxiv - Neuroscience 2022Quote: ... The TauRD(P301S)-YFP plasmid DNA with virus packing pDNAs (psPAX2; pMD2.G, Addgene) was transfected into 293T cells by 1mg/mL PEI transfection reagent and incubated for 36 hours ...
-
bioRxiv - Neuroscience 2024Quote: ... pCAG mt-SypHer was created by PCRing the DNA encoding mt-SypHer from Addgene plasmid #48251 (a gift from Nicolas Demaurex) ...
-
bioRxiv - Neuroscience 2024Quote: ... pCAG 4xmt-iATPSnFR1.0 was created by PCR of the DNA encoding iATPSnFR1.0 from Addgene Plasmid #102556 (a gift from Baljit Khakh) ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were transfected with 0.24μg EGFP-LC3 plasmid DNA (Addgene #11546; Watertown, MA, USA) using the FUGENE6 transfection reagent (Promega ...
-
bioRxiv - Genomics 2023Quote: ... 2.5 ug of DNA (the pegRNA plasmid and the pCMV-PE2 plasmid (Addgene #132775) at a 1:2 ratio by mass of pegRNA plasmid:PE2) ...
-
bioRxiv - Neuroscience 2023Quote: ... either rescue construct along with two helper DNA constructs (pHR-CMV8.2 deltaR (Addgene 8454) and pCMV-VSVG (Addgene 8455) ...
-
bioRxiv - Cell Biology 2023Quote: ... DNA templates for PCR products were as follows - myo-3p from pCFJ104 (Addgene #19328), pgl-1::GFP::FLAG from DUP75 (Andralojc et al. ...
-
bioRxiv - Genetics 2023Quote: ... DNA plasmids used for transgene cloning were lenti-EF1α-dCas9-VPR-Puro (Addgene 99373) (24 ...
-
bioRxiv - Cell Biology 2023Quote: ... Oligo DNAs for the sgRNA were cloned into the lentiCRISPRv2 (plasmid no. 52961; Addgene) vector or pX459 (plasmid no ...
-
bioRxiv - Biochemistry 2024Quote: ... 1ug of DNA was cotransfected with 1ug BxB1 recombinase (pCAG-NLS-BxB1, Addgene #51271) using 3.75uL lipofectamine 3000 and 5uL P3000 reagent in 6 wells of a 6 well plate ...
-
bioRxiv - Biochemistry 2024Quote: ... The DNA sequence of SLC45A4 was cloned to pLPC-N FLAG vector (Addgene, 12521) using BamHI-HF (NEB ...
-
bioRxiv - Cell Biology 2021Quote: ... Single-chain antibodies fused to GFP (scAB-GFP, Addgene #104998) were used for imaging translation sites through nascent polypeptide labeling ...
-
bioRxiv - Cell Biology 2020Quote: ... inhibitor of growth protein-2 (ING2) cDNA was a gift from Curtis Harris (Addgene plasmid # 13294) (Pedeux et al ...
-
bioRxiv - Molecular Biology 2020Quote: HeLa cells were infected with lentivirus carrying the Cas9-BFP (blue fluorescent protein) vector (Addgene 52962). HCT116 and HEK293T were transfected with the same vector using Lipofectamine 2000 (ThermoFisher Scientific ...