Labshake search
Citations for Addgene :
701 - 750 of 913 citations for DNA Mismatch Repair Protein Msh3 MSH3 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... The sensing domain for glucose comprised residues 24–328 of the bacterial D-galactose-binding periplasmic protein (MglB) (Addgene plasmid #163115). Site saturation mutagenesis was carried out according to a previous protocol (Liu & Naismith ...
-
bioRxiv - Biochemistry 2024Quote: Mutations of phosphorylation sites within the SR region were generated via site-directed mutagenesis based on either the tag-free SARS-CoV-2 Nucleocapsid protein plasmid (Addgene, #177937) or the Strep-tagged SARS-CoV-2 Nucleocapsid protein plasmid (Dr ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cas9 editing efficiency in all cell lines was confirmed to be >90% based on tests using the fluorescent protein editing reporter pKLV2-U6gRNA5(gGFP)-PGKBFP2AGFP-W (Addgene #67980).
-
bioRxiv - Bioengineering 2024Quote: ... microchannels were seeded with Madin-Darby Canine Kidney (MDCK; ATCC) epithelial cells or MDCK cells transduced to express mCherry fluorescent protein (MDCKmCherry, Addgene: 72264). Both MDCK types were cultured in DMEM supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Neuroscience 2024Quote: ... was made by replacing coding sequences from the rabies oG protein with orthologous sequences from N2cG (PCR amplified from Addgene #73481). High scoring predicted splice donor and splice acceptor sites on the N2cG sense sequence were mitigated by introduction of synonymous codon substitutions to enhance protein expression.26 pAAV-ehSyn-fDIO-TVA950-eYFP ...
-
bioRxiv - Cell Biology 2024Quote: ... was generated by amplifying the coding sequence of the green fluorescent protein mGreenLantern49 from a LifeAct-mGreenLantern plasmid (git from G. Petsko, Addgene #164459), and inserted with a SG linker after the C-ter of PIEZO1 plasmid ...
-
bioRxiv - Cell Biology 2024Quote: ... Vimentin was first amplified from from human cDNA encoding isoform 1 (VIM-201, protein 466aa) and cloned in to the KIF1A(1-365)-GFP-SspB plasmid (Addgene #174629) (Nijenhuis et al. ...
-
bioRxiv - Biochemistry 2024Quote: ... or an N-terminal TEV protease-cleavable His6-maltose binding protein tag (UC Berkeley Macrolab vector 2C-T, Addgene ID 29706). Vectors were transformed into E ...
-
bioRxiv - Cancer Biology 2024Quote: ... The sgRNA vector encodes an sgRNA driven by a mouse U6 promoter as well as a fluorescent protein (BFP) and puromycin resistance (pac gene) separated by a T2A site (Addgene #217305). To generate lentivirus particles ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were transduced the next day with 1000 ng of plasmid DNA plus 250 ng pMD2.G (Cat# 12259, Addgene) and 750 ng psPax2 (Cat# 12260 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The double-stranded DNA of sgRNAs annealed from synthesized complimentary oligonucleotides were inserted into the pUC57-sgRNA vector (Addgene, 51132), and gRNAs were transcribed in vitro ...
-
bioRxiv - Biophysics 2021Quote: ... Plasmids expressing lacO/tetO targeting sgRNAs with 2xPP7 loops were designed as gBlocks (Integrated DNA Technology) and cloned into a U6 promoter-driven sgRNA expression vector derived from Addgene plasmid #61424 ...
-
bioRxiv - Bioengineering 2020Quote: ... and mRuby2-tagged Lifeact were constructed by inserting the PCR-amplified cDNAs (human TAGLN2, pFN21ASDA0120, Kazusa DNA Research Institute; Lifeact, Addgene plasmid # 54688 ...
-
bioRxiv - Neuroscience 2021Quote: ... The clone with the desired sequence and highest DNA concentration was used for subcloning into the pDESTSplice expression vector (Addgene) using the LR-Gateway System (Invitrogen).
-
bioRxiv - Molecular Biology 2022Quote: ... The EcoRI-HpaI fragment of wild-type or mutant Claspin DNA from mAG-TEV-His-Claspin-Flag3 was inserted at the EcoRI/SnaBI site of pMX-IP (Addgene) to construct retroviral expression vectors ...
-
bioRxiv - Immunology 2020Quote: ... UK) packaging construct in combination with pSuper.mBeta826 (DNA Polβ shRNA, a kind gift from Dr. Robert Sobol, [Addgene, Plasmid #12549]) (Trivedi et al. ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 nM or 37.5 nM of preincubated binary complexes were added to 5 nM of target DNA (eGFP-hAgo2 plasmid (Addgene #21981) linearized with SmaI) ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were cotransfected with two TALEN plasmids inducing DNA double strand breaks at the AAVS1 locus (Addgene #59025 and 59026) (González et al ...
-
bioRxiv - Cell Biology 2020Quote: ... we amplified two DNA fragments with PCR and used Gibson assembly to subclone these into the BamHI site of pBluescript II KS+ (Addgene). The first fragment ...
-
bioRxiv - Cell Biology 2020Quote: ... of a TubB1 sequence fragment synthesised as a gBlock by Integrated DNA Technologies (IDT) and a C-terminal mApple empty backbone (mApple-C1 was a gift from Michael Davidson (Addgene plasmid # 54631 ...
-
bioRxiv - Genetics 2020Quote: ... were annealed and the DNA oligonucleotide duplex was cloned in the Bbs1 restriction site of pSpCas9(BB)-2A-GFP (PX458) plasmid (Plasmid #48138, Addgene). sgRNA sequence was verified by DNA Sanger sequencing using the following primer ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA fragment of Cre was prepared by PCR and transferred to retroviral plasmid backbone (a gift from Fred Gage (Addgene plasmid # 49054 ...
-
bioRxiv - Genomics 2021Quote: ... donor DNA constructs were chemically synthesized and cloned into the pUC19 or pAAV-MCS2 plasmids obtained from Addgene (Watertown, MA). The donors included 400-800 bp homology arms flanking the inserted DNA sequence encoding the FKBP12 degradation tag as well as mScarlet ...
-
bioRxiv - Genetics 2020Quote: ... of homology arms (∼400bp) PCR amplified from genomic DNA and the FKBP12F36V sequence amplified from plasmid pLEX_305-N-dTAG (Addgene # 91797) (Nabet et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... Venus was PCR amplified from the genomic DNA of UAS-CsChrimson.mVenus flies (Klapoetke et al., 2014) and cloned into the 10XQUAS vector (Addgene #163629). Fly line was established through random P-element insertion ...
-
bioRxiv - Biochemistry 2021Quote: DNA encoding human RTCB was cloned into the UC Berkeley MacroLab 4B vector (gift from Scott Gradia, Addgene plasmid #30115). The fusion protein containing an N-terminal His6 tag and a TEV protease cleavage site was expressed in Sf9 insect cells using the Bac-to-Bac Baculovirus expression system (Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293T cells were transfected using calcium phosphate method with 4-6 µg plasmid DNA and 8 µg of each pMD2.G and psPAX2 (Addgene). After 48 h ...
-
bioRxiv - Molecular Biology 2021Quote: The gRNA TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGGTACAGACCAAGTAT G was cloned by Gibson assembly following manufactureŕs instructions (Codex DNA) into the plasmid U6GRNA (Addgene 4148). 1 µg of the resulting plasmid and 0.5 µg of plasmid hCas9 (Addgene 41815 ...
-
bioRxiv - Immunology 2021Quote: ... Yeast scFv display libraries were generated using the amplified VH and VL DNA libraries from above and the pYD1 yeast surface display vector (Addgene plasmid #73447 ...
-
bioRxiv - Developmental Biology 2021Quote: ... we cloned the DNA encoding the TALE repeats and flanking regions into JDS74 (plasmid #32288) and JDS71 (plasmid #32287) vectors (Addgene). The vector OCT4-2A-eGFP-PKG-Puro (plasmid #31938 ...
-
bioRxiv - Cell Biology 2023Quote: ... 2-6×105 cells in a 35 mM well were transfected with 0.4ug of DNA encoding a puro resistance plasmid (pCoPURO, Addgene #17533) using Effectene Transfection Reagent (Qiagen) ...
-
bioRxiv - Neuroscience 2022Quote: ... the complementary DNA (cDNA) for each iMN factor (Ngn2, Lhx3, Isl1, NeuroD1, Ascl1, Brn2 and Myt1l) was purchased from Addgene and cloned into the pMXs retroviral expression vector using Gateway cloning technology (Invitrogen) ...
-
bioRxiv - Neuroscience 2023Quote: ... UBA5) were generated as described above with the following modifications: third-generation packaging DNA mix containing pRSV-REV (Addgene #12253), pMDLg/pRRE (Addgene #12251) ...
-
bioRxiv - Bioengineering 2023Quote: A DNA sequence encoding the CD47 Ig-like domain (Gln19 – Ser135) was cloned into the pCTCON2 yeast-surface display vector (Addgene) using the NheI and BamHI sites ...
-
bioRxiv - Biophysics 2023Quote: ... Plasmid DNA for expressing CRY2olig tagged with mCherry at its C-terminus was obtained from Addgene (#60032; Watertown, MA, USA). The plasmid (1.0 µg/dish ...
-
bioRxiv - Genomics 2023Quote: ... The original CRISPRoff plasmid DNA (except the region encoding TagBFP) and mScarletI cDNA from the pmScarlet-i_C1 plasmid (Addgene # 85044) were amplified by polymerase chain reaction (PCR ...
-
bioRxiv - Immunology 2023Quote: DNA inserts containing the coding DNA sequence (CDS) for each wild type gene were generated by restriction digestion previous amplification from plasmids obtained from Addgene (hMX1 ...
-
bioRxiv - Genomics 2023Quote: ... the DNA sequence of KRAB repressor domain was amplified by PCR from the pHAGE TRE dCas9-KRAB (Addgene plasmid #50917) and cloned in frame into the PB-TRE-dCas9-VPR backbone (Addgene plasmid #63800 ...
-
bioRxiv - Cancer Biology 2024Quote: ... two sgRNAs were synthesized together with bovine U6 promoter as gene blocks (Integrated DNA Technologies) and cloned using Gibson assembly into LRG2.1T (Addgene, 65656). All inserts were verified by Sanger sequencing (Eurofins Genomics) ...
-
bioRxiv - Neuroscience 2024Quote: ... the DNA mixture consisted in 20 μg of specific DNA and 10 μg each of psPax2 and pMD2.G plasmids (from Dr. Didier Trono, Addgene) and 250 mM CaCl2 (in a final volume of 500 ul ...
-
bioRxiv - Immunology 2024Quote: ... targeting CYLD was cloned by annealing two DNA oligos (forward, 5’-GTGGTCAAGGTTTCACTGAC-3’; reverse, 5’-GTCAGTGAAACCTTGACCAC-3’) and ligating into lentiCRISPER v2 (52961, Addgene) plasmids ...
-
bioRxiv - Developmental Biology 2023Quote: ... expressing a dominant negative variant of the rol-6 gene and an empty vector pSK (up to 200 ng μl-1 of DNA) (Addgene) using standard methods (42) ...
-
bioRxiv - Cell Biology 2023Quote: ... The sgRNA expression vectors were generated by cloning appropriate DNA oligonucleotides (Supplementary Table 2) into the BbsI restriction sites of the pX459 vector (#62988, Addgene). An empty pX459 vector was used to generate matching control cell lines ...
-
bioRxiv - Biochemistry 2023Quote: ... the open reading frame of QBP was amplified from E.coli K12 DNA and cloned into bacterial expression vector pET28a-LIC (Addgene #26094). Transformed E.coli BL21 (DE3) ...
-
Spray-induced gene silencing (SIGS) as a tool for the management of Pine Pitch Canker forest diseasebioRxiv - Plant Biology 2024Quote: For dsRNA vectors assembly, constructs sequences were synthesized in Integrated DNA Technologies (IDT, Coralville, IA, USA) and cloned into the T777T plasmid (Addgene plasmid # 113082 ...
-
bioRxiv - Immunology 2022Quote: ... two oligonucleotide pairs carrying sgRNA sequences were designed to target XIRP1 and ordered (Integrated DNA Technologies) for cloning into pSpCas9(BB)-2A-Puro (pX459) V2.0 (Addgene, 62988). A pair was designed targeting a region upstream of the translational start site and consisted of 5’-CACCGGG AGTGACCATGGTACCAC-3’ and 5’-AAACGTGGTACCATGGTCACTCCC-3’ ...
-
bioRxiv - Developmental Biology 2022Quote: ... HDR donor plasmids carrying wild type me31B gene were constructed by cloning me31B gene DNA into pHD-sfGFP-ScarlessDsRed cloning vector (Addgene) according to suggested protocols ...
-
bioRxiv - Cell Biology 2022Quote: ... The sgRNA expression vectors were generated by cloning appropriate DNA oligonucleotides (Suppl. Table 3) in the BbsI restriction sites of pX459 (#62988, Addgene). An empty pX459 vector was used to generate matching negative control cell lines ...
-
bioRxiv - Microbiology 2023Quote: ... and lentiviral particles expressing human TMPRSS2 (selection with 1 mg/ml G418). The TMPRSS2 (cat. 145843) and ACE2 (cat. 145839) lentiviral DNA clones (23) were purchased from Addgene and transfected into HEK293T cells together with pSPAX2 (Addgene ...
-
bioRxiv - Biochemistry 2022Quote: ... The DNA fragments were purified and cloned into a pOPINJ vector (a kind gift from Ray Owens, Addgene plasmid 26045) to encode a 3C-cleavable His6-GST-fusion using In-Fusion enzyme (Clontech ...