-
No products found
because this supplier's products are not listed.
Kuan-Ying A. Huang, et al.,
bioRxiv - Microbiology 2020
Quote:
... or SARS antigen (spike glycoprotein S1 subunit: Sino Biological, China) or Middle East Respiratory Syndrome coronavirus (MERS ...
-
No products found
because this supplier's products are not listed.
Eva Fisher, et al.,
bioRxiv - Immunology 2020
Quote:
... Recombinant human coronavirus SARS-CoV-2 spike glycoprotein S1 (Fc Chimera) (ab272105, Abcam) was used as positive control (loaded 2.4 ug/lane) ...
-
No products found
because this supplier's products are not listed.
M. A. Rossotti, et al.,
bioRxiv - Bioengineering 2021
Quote:
Recombinant coronavirus spike glycoproteins S (Table S1) were coated overnight onto NUNC® Immulon 4 HBX microtiter plates (Thermo Fisher) at 50 ng/well in 100 µL of PBS ...
-
No products found
because this supplier's products are not listed.
Thomas Mandel Clausen, et al.,
bioRxiv - Microbiology 2020
Quote:
... and SARS-CoV-2 spike protein (ECD, His & Flag Tag) (GenScript Z03481). Proteins were biotinylated using EZ-Link™ Sulfo-NHS-Biotin ...
-
No products found
because this supplier's products are not listed.
Sebastian Fiedler, et al.,
bioRxiv - Biochemistry 2020
Quote:
SARS-CoV-2 spike S1 (S1N-C52H4, ACROBiosystems) and the extracellular domain of ACE2 (AC2-H52H8 ...
-
No products found
because this supplier's products are not listed.
Laura Pellegrini, et al.,
bioRxiv - Neuroscience 2020
Quote:
... mouse anti-SARS-CoV-2 spike glycoprotein (1:200, GeneTex, GTX632604), rabbit anti-SARS-CoV-2 spike glycoprotein C-terminal (1:200 ...
-
No products found
because this supplier's products are not listed.
Cherrelle Dacon, et al.,
bioRxiv - Immunology 2022
Quote:
... and 1μg truncated coronavirus spike expressing plasmids (SARS: Addgene #170447 ...
-
No products found
because this supplier's products are not listed.
Irfan Ullah, et al.,
bioRxiv - Immunology 2021
Quote:
... using cross-reactive anti-SARS-CoV-1 Spike CR3022 or mouse anti-His tag (Sigma-Aldrich) as positive controls ...
-
No products found
because this supplier's products are not listed.
Naoki Iwanaga, et al.,
bioRxiv - Immunology 2020
Quote:
ELISA plates were coated with 2 μg/mL recombinant spike glycoprotein receptor binding domain (RBD) from SARS-CoV-2 (BEI RESOURCES) or recombinant S1 subunit (RayBiotech) overnight at 4 °C ...
-
No products found
because this supplier's products are not listed.
Setsuko Mise-Omata, et al.,
bioRxiv - Immunology 2022
Quote:
... Recombinant human SARS-CoV-2 spike S1 IgG lyophilized antibody (Clone AM009105, BioLegend) was used as a standard.
-
No products found
because this supplier's products are not listed.
Andre Watson, et al.,
bioRxiv - Bioengineering 2020
Quote:
... with pseudotyped lentivirions displaying the SARS-CoV-2 spike glycoprotein (BPS Bioscience). A neutralizing monoclonal IgG antibody against the SARS-CoV-2 spike glycoprotein (CR3022 ...
-
Recombinant Antigen
Cat# REC31809-100,
100µg USD $525.0
Ask
Maya Imbrechts, et al.,
bioRxiv - Immunology 2021
Quote:
The binding of the purified recombinant antibodies to the following SARS-CoV-2 antigens was assessed via ELISA: spike glycoprotein (S1) RBD-His (REC31849-500, The Native Antigen Company), RBD(N439K)-His (40592-V08H14 ...
-
No products found
because this supplier's products are not listed.
Elena Kudryashova, et al.,
bioRxiv - Immunology 2021
Quote:
... Recombinant SARS-CoV-2 Spike glycoprotein was purchased from R&D Systems (Minneapolis, MN). Bovine serum albumin (BSA ...
-
No products found
because this supplier's products are not listed.
Sherif Salah, et al.,
bioRxiv - Immunology 2022
Quote:
Different SARS-CoV-2 coronavirus antigen concentrations (5, 10, 20, 40, and 80 μg/ml) of spike protein (S1) (by ProSci Inc.), nucleocapsid protein ...
-
No products found
because this supplier's products are not listed.
Juliana Nunes Rosón, et al.,
bioRxiv - Microbiology 2021
Quote:
... anti-His Tag (Cell Signaling) 1:3000 ...
-
No products found
because this supplier's products are not listed.
Cheerneni S Srinivas, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and His-tag (11965085001, Roche) antibodies were used to detect the proteins.
-
No products found
because this supplier's products are not listed.
Federico Bertoglio, et al.,
bioRxiv - Biochemistry 2020
Quote:
... S1-His or RBD-His were labelled using Monolith NTTM His-Tag Labeling Kit RED-tris-NTA (Nanotemper) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Felix Alonso-Valenteen, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... HIS-tag (Qiagen 34610 1:100) and HER3 (R&D Systems AF4518 1:400) ...
-
No products found
because this supplier's products are not listed.
Tarlan Mamedov, et al.,
bioRxiv - Bioengineering 2020
Quote:
... or anti-SARS-COV2 COVID 19 Spike Protein Coronavirus Monoclonal Antibody (MyBioSource, cat. no. MBS2563837). The image was taken using highlysensitive GeneGnome XRQ Chemiluminescence imaging system (Syngene ...
-
No products found
because this supplier's products are not listed.
Xiaobo Zhong, et al.,
bioRxiv - Microbiology 2023
Quote:
... a His-Tag monoclonal antibody (Proteintech) and an Anti-Mouse lgG-Alkaline Phosphatase (Sigma ...
-
No products found
because this supplier's products are not listed.
Sven H. Schmidt, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and the His-tag of Rab8a (anti-His-Antibody, GE Healthcare, mouse). Both were diluted (1:1000 ...
-
No products found
because this supplier's products are not listed.
Ling Xu, et al.,
bioRxiv - Cell Biology 2024
Quote:
... These sample series were transferred to a plate pre-coated with the spike glycoprotein S1-RBD from SARS-CoV-2 (Elabscience, China, E-EL-E605). After 2 h of incubation ...
-
No products found
because this supplier's products are not listed.
Michael Korenkov, et al.,
bioRxiv - Immunology 2023
Quote:
... and the corresponding SARS-CoV-2 spike construct were co-transfected in HEK293-T cells using FuGENE 6 Transfection Reagent (Promega) in Dulbecco’s Modified Eagle Medium (DMEM ...
-
No products found
because this supplier's products are not listed.
Julio Aguado, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The full-length Spike glycoprotein was subsequently amplified with Prime Star GXL DNA polymerase (Takara Bio) and the following primers CoV-SF GATAAAGGAGTTGCACCAGGTACAGCTGTTTTAAG CoV-SR GTCGTCGTCGGTTCATCATAAATTGGTTCC and conditions as per previously described50 ...
-
No products found
because this supplier's products are not listed.
Raveen Rathnasinghe, et al.,
bioRxiv - Microbiology 2020
Quote:
... stained with a mAb cocktail composed of SARS-CoV-2 spike (Creative-Bios; 2BCE5) and SARS-CoV-2 nucleoprotein (Creative-Biolabs; NP1C7C7) followed by anti-Mouse IgG-HRP (Abcam ab6823 ...
-
No products found
because this supplier's products are not listed.
Brien K. Haun, et al.,
bioRxiv - Immunology 2020
Quote:
... covering the N-terminal S1 domain of the Spike protein of SARS-CoV-2 (Miltenyi Biotec, Auburn, CA) at 0.2 μg/mL and 0.5 μg/mL per peptide ...
-
No products found
because this supplier's products are not listed.
Alexandra Atalis, et al.,
bioRxiv - Immunology 2022
Quote:
Adjuvanted PLGA-PEI NPs and the S1 subunit of the SARS-CoV-2 spike protein (Novus Biologicals, Cat# NBP2-90985 ...
-
No products found
because this supplier's products are not listed.
Christoffer Rode, et al.,
bioRxiv - Systems Biology 2023
Quote:
... Primary his tag antibody (05-949, Merck), stored in a skim milk solution ...
-
No products found
because this supplier's products are not listed.
Andre Watson, et al.,
bioRxiv - Bioengineering 2020
Quote:
... A neutralizing monoclonal IgG antibody against the SARS-CoV-2 spike glycoprotein (CR3022, antibodies-online), ACE2 (Sino Biological) ...
-
No products found
because this supplier's products are not listed.
Sylwia D. Tyrkalska, et al.,
bioRxiv - Immunology 2021
Quote:
... wild type Spike S1 (cat. #RP01262), Spike S1+S2 (cat. #RP01283LQ) and Envelope protein (E, cat. #RP01263) (from ABclonal), flagellin (Invivogen ...
-
No products found
because this supplier's products are not listed.
Shiho Tanaka, et al.,
bioRxiv - Immunology 2021
Quote:
... recombinant SARS-CoV-2 S2-His-tag at 10 µg/mL was loaded on Anti-Penta-HIS (HIS1K) biosensors (Sartorius Corporation) for 1 min ...
-
No products found
because this supplier's products are not listed.
Andrew C. Yang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... sections were incubated for 45 minutes at room temperature with the anti-SARS spike glycoprotein antibody 3A2 (rabbit, Abcam ab272420 1:100 diluted in Dako REAL antibody diluent #S2022), which has been validated in previous publications20,41 ...
-
No products found
because this supplier's products are not listed.
Steven Swendeman, et al.,
bioRxiv - Biochemistry 2022
Quote:
... and His-tag (Santa Cruz) expression (data not shown) ...
-
No products found
because this supplier's products are not listed.
Trung The Tran, et al.,
bioRxiv - Immunology 2022
Quote:
... cDNA encoding His-tagged Spike and RBD variants of SARS-CoV-2 were sub-cloned into pFUSE2ss-CLIg-hk (InvivoGen). The vectors were transfected as described for above the ACE2-albumin fusion protein and secreted His-tagged proteins were purified on HisTrap™ HP 1 mL columns (Cytiva) ...
-
No products found
because this supplier's products are not listed.
Asha A. Philip, Sannoong Hu, John T. Patton,
bioRxiv - Microbiology 2023
Quote:
... or His-tag antibody (MCA1396, Bio-Rad, 1:1000), or rabbit monoclonal β-actin antibody (D6A8 ...
-
No products found
because this supplier's products are not listed.
Peter Vandeberg, et al.,
bioRxiv - Immunology 2020
Quote:
Anti-SARS-CoV-2 IgG titers were determined using Human Anti-SARS-CoV-2 Virus Spike 1 (S1) IgG assay (Alpha Diagnostic). hIVIG batches were tested using multiple serial dilutions and a curve constructed by plotting the log of the optical density as a function of the log of the dilution ...
-
No products found
because this supplier's products are not listed.
Asheley P. Chapman, et al.,
bioRxiv - Immunology 2020
Quote:
... His-S1 or ecto-spike proteins were plated on half-area high-binding 96-well polystyrene plates (Corning) at 1 μg/mL or 0.5 μg/mL ...
-
No products found
because this supplier's products are not listed.
Lie Wang, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Purified hDGAT1 (with his tag) was absorbed onto Copper HIS-Tag PVT beads (Perkin Elmer, RPNQ0095) and incubated with [3H]-Acetyl-CoA (ARC ...
-
No products found
because this supplier's products are not listed.
Blake M. Hauser, et al.,
bioRxiv - Immunology 2021
Quote:
... SARS-CoV-2 spike-StreptTactin PE (StrepTactin PE from IBA Lifesciences), and SARS-CoV-2 spike-StreptTactin APC (StrepTactin APC from IBA Lifesciences).
-
No products found
because this supplier's products are not listed.
Aljawharah Alrubayyi, et al.,
bioRxiv - Immunology 2021
Quote:
... 1.4 µg of WT-SARS-CoV-2 spike plasmid (2) and 60 µg of PEI-Max (Polysciences). Supernatants were harvested 48h later ...
-
No products found
because this supplier's products are not listed.
Ryosuke Saigusa, et al.,
bioRxiv - Immunology 2022
Quote:
... sample tags: 600 reads per cell on Illumina NovaSeq using S1 and S2 100 cycle kits (Illumina) (67×8×50 bp) ...
-
No products found
because this supplier's products are not listed.
Paul-Henri Romeo, et al.,
bioRxiv - Cell Biology 2023
Quote:
... SARS-CoV-2 Spike antibody (Active Motif, clone AM001414) was used for neutralization at 10nM.
-
No products found
because this supplier's products are not listed.
B Balakrishnan, K Lai,
bioRxiv - Biochemistry 2021
Quote:
... anti-SARS-CoV-2 Spike Protein was purchased from Origene Technologies Inc ...
-
No products found
because this supplier's products are not listed.
Romain Rouet, et al.,
bioRxiv - Immunology 2022
Quote:
... spike and SARS-CoV-1 RBD were incubated with Streptavidin-APC (BD), Streptavidin-PE (BD) ...
-
No products found
because this supplier's products are not listed.
Antonella Conforti, et al.,
bioRxiv - Immunology 2021
Quote:
... transfected with 44 μg plasmid encoding SARS-CoV-2 Spike (pCG1-SARS-2-S, Wuhan Hu-1) using Transit LT-1 (Mirus). The next day ...
-
No products found
because this supplier's products are not listed.
Sijie Yang, et al.,
bioRxiv - Immunology 2024
Quote:
... the SARS-CoV-2 spike protein expression plasmid was transfected into 293T cells(American Type Culture Collection (ATCC, CRL-3216). Following transfection ...
-
No products found
because this supplier's products are not listed.
Brett Stern, Peter Monteleone, Janet Zoldan,
bioRxiv - Bioengineering 2022
Quote:
Viral spike protein (either SARS-CoV-2 Spike Protein, S1 Subunit, RayBiotech, or MERS-CoV-1 Spike Protein, S1 Subunit, BioVision) was added to endothelial culture media of CD34+ iPSC-EP-laden hydrogels at a concentration of 10 μg/mL either one or five days after cell encapsulation ...
-
SARS-CoV-2, Recombinant Protein, Eta, variant B.1.525, Spike S1 Protein, Q52R, A67V, 69-70...
Cat# VReP-GCY092,
1.0 case, Inquiry
Ask
Xiaotian Tan, et al.,
bioRxiv - Bioengineering 2020
Quote:
... The human-cell-expressed SARS-CoV Spike S1-His recombinant protein was purchased from Creative Biolabs (VAng-Wyb7337). The recombinant CR3022 therapeutic antibody was purchased from Creative Biolabs (MRO-1214LC) ...
-
No products found
because this supplier's products are not listed.
Matthew J. Burke, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Single-cell clones were then assessed for binding to His-tagged SARS-CoV-2 Spike using a Cytoflex S (Beckman) cell analyser ...
-
No products found
because this supplier's products are not listed.
James B. Winans, et al.,
bioRxiv - Microbiology 2022
Quote:
... was stained with Anti-6X His Epitope Tag (Rabbit) antibody conjugated to Dylight 405 (Rockland Immunochemicals, cat. # 600-446-382) added to the media at a concentration of .1μg/mL for the entirety of the experiment ...