-
No products found
because this supplier's products are not listed.
Hyesoo Kim, Itay Budin,
bioRxiv - Biophysics 2023
Quote:
... tryptophan (Alfa Aesar) (20 mg/L) ...
-
No products found
because this supplier's products are not listed.
Icnelia Huerta-Ocampo, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and rabbit tryptophan hydroxylase 2 (1:500, Novus Biological, NB100-7455), respectively ...
-
No products found
because this supplier's products are not listed.
Xiaoning Gao, et al.,
bioRxiv - Cell Biology 2024
Quote:
... ELISA kits from Solarbio, catalogue numbers SEKR-0002 ...
-
No products found
because this supplier's products are not listed.
Michael A. Flinn, et al.,
bioRxiv - Physiology 2022
Quote:
Primary cardiac fibroblasts were isolated from 2-day-old rats using a neonatal heart dissociation kit (Miltenyi Biotec) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
H. Mark Kenney, et al.,
bioRxiv - Immunology 2022
Quote:
... AlexaFluor 647 F(ab’)2 fragment donkey anti-rat IgG (Jackson ImmunoResearch, Cat# 712-606-153 ...
-
No products found
because this supplier's products are not listed.
Rebekka Karlowitz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
-
No products found
because this supplier's products are not listed.
Ayan Dey, et al.,
bioRxiv - Immunology 2021
Quote:
Competitive inhibition ELISA was performed using SARS-CoV-2 neutralization antibody detection kit (Genscript). The kit detects circulating neutralizing antibodies against SARS-CoV-2 that block the interaction between the receptor binding domains of the viral spike glycoprotein (RBD ...
-
No products found
because this supplier's products are not listed.
Clément Blot, et al.,
bioRxiv - Microbiology 2023
Quote:
... Nrf2 TransAM ELISA-kit (Active Motif) was used to evaluate Nrf2 DNA-binding activity ...
-
No products found
because this supplier's products are not listed.
Loredana Leggio, et al.,
bioRxiv - Neuroscience 2021
Quote:
... or rat-anti-CD63 (MBL, D263-3)) in 0.1% BSAc (Electron Microscopy Sciences) for 1 h ...
-
No products found
because this supplier's products are not listed.
Jelena Osmanovic Barilar, et al.,
bioRxiv - Neuroscience 2021
Quote:
... ELISA kit was purchased from Tecan IBL International (Hamburg ...
-
No products found
because this supplier's products are not listed.
Elisa Vaiani, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... inhibin B and AMH/MIS by 2-site ELISA (Beckman Coulter and Beckman Coulter Gen II ...
-
No products found
because this supplier's products are not listed.
Eloise J. Lockyer, et al.,
bioRxiv - Microbiology 2022
Quote:
... then treated wells were supplemented with 1mM L-tryptophan (VWR, J62508-09) dissolved in 0.1N NaOH at the same time as IFNγ stimulation ...
-
No products found
because this supplier's products are not listed.
João Pedro Fonseca, et al.,
bioRxiv - Systems Biology 2020
Quote:
... Measurements for cAMP ELISA and BCA Protein Assay kits were performed in a FlexStation 3 Multi-Mode Microplate Reader (Molecular Devices). The cAMP dose response to light was fit to a hyperbolic equation and confidence intervals were extracted by bootstrapping in a custom Python Script available on GitHub (https://qithub.com/jpfon/cAMP).
-
No products found
because this supplier's products are not listed.
Astrid Veß, Thomas Hollemann,
bioRxiv - Cell Biology 2020
Quote:
2×105 cells were subjected to the Caspase-3/CPP32 Fluorometric Assay Kit (BioVision) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Fok-Moon Lum, et al.,
bioRxiv - Immunology 2019
Quote:
... The DNase-treated RNA (2 μg) was treated with Ribo-Zero using an Epicentre Ribo-Zero Gold Kit (Human/Rat/Mouse) (Epicentre) and re-purified on Ampure XP beads.
-
No products found
because this supplier's products are not listed.
Shuangfen Tao, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... The ELISA for Bcl-2 was performed using a human Bcl-2 ELISA kit (LS-F4134, LSbio Lifespan Biosciences Inc, Seattle, WA, USA).
-
No products found
because this supplier's products are not listed.
Patrícia D. Correia, et al.,
bioRxiv - Neuroscience 2023
Quote:
... rats were anesthetized with Isoflurane (Forene, Abbott; 2–3% in O2 and N2O at a ratio of 1:2). Following laminectomy at T8/9 and opening of the dura mater via a longitudinal cut ...
-
No products found
because this supplier's products are not listed.
Qingwen Qian, et al.,
bioRxiv - Physiology 2022
Quote:
... were measured using commercially available ELISA kits (TSH ELISA kit, G-Biosciences, Cat No. IT6045; free T3 ELISA kit, G-Biosciences, Cat No. IT5691; T4 ELISA kit, G-Biosciences, Cat No ...
-
No products found
because this supplier's products are not listed.
Rebecca S. Hofford, et al.,
bioRxiv - Neuroscience 2020
Quote:
A morphine ELISA kit (Abnova #KA0935) was used to quantify morphine in serum and DStr ...
-
No products found
because this supplier's products are not listed.
Adam J. Rocker, et al.,
bioRxiv - Bioengineering 2022
Quote:
... ELISA color development was monitored with an ELISA plate reader (BioTek Synergy 2 Multi-Mode Reader) at 405 nm with wavelength correction set at 650 nm ...
-
No products found
because this supplier's products are not listed.
Daniel A. Kramer, et al.,
bioRxiv - Biochemistry 2023
Quote:
... The GST-ICD tryptophan mutations (“black” W22X) were purified through Glutathione Sepharose beads (GE Healthcare), followed by dialysis into pull-down buffer containing 100 mM NaCl ...
-
No products found
because this supplier's products are not listed.
Pragya D Yadav, et al.,
bioRxiv - Microbiology 2021
Quote:
... Briefly, ACE-2 protein (Acro Biosystems, USA) was coated onto ELISA plates (Greiner, Germany) at 1 μg/mL concentration in PBS and was incubated (for 12-72 hours ...
-
No products found
because this supplier's products are not listed.
Gaoyang Liang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... A Luna C18(2) C8 column (3 μm, 2 mm × 50 mm, Phenomenex) was used ...
-
No products found
because this supplier's products are not listed.
Gunsagar S. Gulati, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 2-to-3-month-old C57BL/6J female mice (Jackson Laboratory) were used for fluorescent-minus-one (FMO ...
-
No products found
because this supplier's products are not listed.
MD Fahlberg, et al.,
bioRxiv - Immunology 2020
Quote:
Tryptophan and Kynurenine plasma concentrations were measured by using the Tryptophan ELISA (Rocky Mountain Diagnostics, Colorado Springs ...
-
No products found
because this supplier's products are not listed.
Seyed. M. Ghiasi, et al.,
bioRxiv - Cell Biology 2023
Quote:
Insulin concentration (ng/ml or pM) was measured using rat insulin ultra-sensitive ELISA kit (Cat#62IN2PEG, Cisbio, Cambridge, England) or human insulin ELISA kit (Cat#90095 ...
-
No products found
because this supplier's products are not listed.
Zhiqing Huang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Enzyme-linked immunosorbent assays (ELISA) using the human POSTN ELISA kit from Aviva Systems (Cat # OKCD09048 ...
-
No products found
because this supplier's products are not listed.
Ann Castelfranco, Pepe Alcami,
bioRxiv - Neuroscience 2023
Quote:
... and 3% lead citrate (Ultrostain 2, Leica).
-
No products found
because this supplier's products are not listed.
Kamal L Nahas, et al.,
bioRxiv - Cell Biology 2021
Quote:
3 mm gold EM grids with a holey carbon film (R 2/2, 200 mesh; Quantifoil Cat no ...
-
No products found
because this supplier's products are not listed.
S. L. Heaver, et al.,
bioRxiv - Microbiology 2021
Quote:
... lipids were extracted according to the PI(3)P Mass ELISA Kit (Echelon Biosciences Inc.) protocol ...
-
No products found
because this supplier's products are not listed.
Ann Marie Centner, et al.,
bioRxiv - Cell Biology 2024
Quote:
... A commercial Cotinine ELISA kit (Origene) suitable for mice was used to quantify blood levels ...
-
No products found
because this supplier's products are not listed.
Tyler B. Waltz, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Depletion of p11 from the media was confirmed using Rat S100 Calcium Binding Protein A10 (S100A10) ELISA Kit (Biomatik, Cat# EKN48271-96T) as per the attached instructions.
-
No products found
because this supplier's products are not listed.
Timur O Yarovinsky, et al.,
bioRxiv - Immunology 2019
Quote:
... We used HBsAg ELISA kit from XpressBio and the HBsAg standard from CellBioLabs to measure serum HBsAg in the chronic HBV infection model.
-
No products found
because this supplier's products are not listed.
Marta E. Stremska, et al.,
bioRxiv - Immunology 2023
Quote:
... 3 μm (#19118-2; Polysciences) or 6 μm (#17145-4 ...
-
No products found
because this supplier's products are not listed.
Jesse M. Hall, et al.,
bioRxiv - Microbiology 2021
Quote:
... ELISA plates were washed as described above and 100μl of secondary goat anti-rat IgG (SouthernBiotech Cat. 3030-04), goat anti-rat IgM (SouhternBiotech Cat ...
-
No products found
because this supplier's products are not listed.
Rosemary A. Bamford, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Immunocytochemistry was performed with the following primary antibodies: rat anti-GFP (Chromotek, 50430-2-AP) 1:500 ...
-
No products found
because this supplier's products are not listed.
Stefania Capone, et al.,
bioRxiv - Immunology 2020
Quote:
RBD/ACE-2 neutralization ELISA (ACROBiosystems) was performed according to manufacturer instruction ...
-
No products found
because this supplier's products are not listed.
Alia Hasan, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Serum PTH or PTH secreted to growth medium in organ cultures was measured using rat or mouse 1–84 Intact PTH ELISA kit (Quidel, Athens, Ohio).
-
No products found
because this supplier's products are not listed.
Nina R. Montoya, et al.,
bioRxiv - Microbiology 2022
Quote:
... The plates were developed with TMB (3, 3’, 5, 5’ - Tetramethylbenzidine) ELISA Peroxidase Substrate (Rockland Immunochemical, Limerick, PA), and absorbance was measured on a plate reader at 655 nm.
-
No products found
because this supplier's products are not listed.
Alexander Belyy, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 2 mM 3’-deoxyguanosine-5’-triphosphate (3’-dGTP, Jena Bioscience) and 4 mM MgCl2 ...
-
No products found
because this supplier's products are not listed.
Satoshi Watanabe, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2 and 3 (3M and 6M, mEPSCs), 2 and 6 (3M and 6M ...
-
No products found
because this supplier's products are not listed.
Ana E. Cartaya, et al.,
bioRxiv - Physiology 2023
Quote:
... followed by donkey anti-rat CF750 (2 µg/mL, 20857, Biotium). Slides were imaged with the Slideview VS200 (Olympus ...
-
No products found
because this supplier's products are not listed.
Alberto Rissone, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... AG1478 (used 2-3 µM, Calbiochem, cat. # 658552) and 6-BIO (0.2 µM ...
-
No products found
because this supplier's products are not listed.
Michael T.S. Girling, et al.,
bioRxiv - Animal Behavior and Cognition 2024
Quote:
The MethylFlash Global DNA Methylation (5-mC) ELISA Easy Kit (Epigentek, USA), utilising a colourimetric assay ...
-
No products found
because this supplier's products are not listed.
Michael Lawless, et al.,
bioRxiv - Physiology 2019
Quote:
Neonatal rat ventricular myocytes (NRVMs) were isolated from 2-day old Wistar rats and plated onto 8 well plates (Ibidi µ-plates; Thistle Scientific UK) at a density of ~ 3 × 105 cells/ml in media (containing ...
-
No products found
because this supplier's products are not listed.
Ella J. Gehrke, et al.,
bioRxiv - Genetics 2023
Quote:
... OCT was performed at 2- and 3-weeks post-injection (WPI), then 1- ...
-
Lower in secondary proteolytic contaminant activities but with typical collagenase activity. ...
Cat# LS004183,
5 gm, $900.00
Ask
Valeria Rudman-Melnick, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... and 65 mg of the minced tissue was placed in 2 ml digestion buffer containing 3 mg/mL Type 2 collagenase (Worthington, Collagenase Type 2), 1.5 mg/mL ProNase E (Sigma P6911) ...
-
No products found
because this supplier's products are not listed.
Mohit Rajabhoj, et al.,
bioRxiv - Plant Biology 2023
Quote:
... from 2 to 3-day-old WT and mea-1-/-;dme-2-/- seedlings using NucleoSpin® Plant II (MACHEREY-NAGEL). 200 ng of DNA was subjected to fragmentation using ultrasonicator (Covaris ...
-
No products found
because this supplier's products are not listed.
Camille Danne, et al.,
bioRxiv - Immunology 2022
Quote:
Mice were administered drinking water supplemented with 2-3% (wt/vol) DSS (MP Biomedicals) for 5-7 days (depending on colitis severity of each experiment) ...
-
No products found
because this supplier's products are not listed.
James Chen, et al.,
bioRxiv - Biophysics 2021
Quote:
... 3-([3-cholamidopropyl]dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, Anatrace) was added to the sample (8 mM final) ...