-
Rat Tryptophan 2,3-Dioxygenase (TDO2) ELISA Kit is an ELISA Kit for the in vitro quantitative...
Cat# abx556252-96T,
96 tests USD $797.5
Ask
Robert Schierwagen, et al.,
bioRxiv - Molecular Biology 2021
Quote:
We determined plasma levels of beta-arrestin-2 using an ELISA kit (Human Beta-arrestin-2 ELISA Kit; # abx251362; Abbexa) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Emily A. Rex, et al.,
bioRxiv - Microbiology 2023
Quote:
... IP of total SUMOylated protein fractions used either SUMO-1 or SUMO-2/3 Ab included with the Signal Seeker SUMOylation 1 or 2/3 Detection Kit (Cytoskeleton) and IPs were carried out according to the manufacturer instructions ...
-
No products found
because this supplier's products are not listed.
Seokho Kim, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... Active GLP-1 (7-36) was measured using the Mouse / Rat GLP-1 Active (7-36) ELISA Kit (Eagle Biosciences, GP121-K01).
-
Cat# HY-W012480-500 mg,
500 mg, USD $50.0
Ask
Kangkang Niu, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... and RG108 (N-phthalyl-L-tryptophan, HY-13642, MedChemExpress, NJ, USA) were dissolved in DMSO (dimethyl sulfoxide) ...
-
No products found
because this supplier's products are not listed.
Stavros Giaglis, et al.,
bioRxiv - Immunology 2021
Quote:
... utilizing the human TAT Complexes ELISA Kit (Assaypro) and the Imuclone D-Dimer ELISA Kit (American Diagnostica ...
-
No products found
because this supplier's products are not listed.
Takuma Hayashi, Motoki Ichikawa, Ikuo Konishi,
bioRxiv - Immunology 2022
Quote:
... cTnT ELISA: Serum cTnT levels were determined with mouse cTnT ELISA Kit (CUSABIO TECHNOLOGY LLC, Houston, TX, USA) according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Saritha S. D’Souza, et al.,
bioRxiv - Cell Biology 2021
Quote:
... A p27 ELISA (Zeptometrix) was performed on each time point according to the manufacturer’s instructions to determine the amount of virus produced in each well.
-
No products found
because this supplier's products are not listed.
M. Kawai, M. Nie, H. Oda, S. Takeuchi,
bioRxiv - Bioengineering 2024
Quote:
... Keratinocyte Growth Medium 3 Kit was purchased from PromoCell GmbH (Heidelberg ...
-
No products found
because this supplier's products are not listed.
Marina Wright Muelas, et al.,
bioRxiv - Biochemistry 2020
Quote:
... L-Tryptophan-(indole-d5) (Cambridge Isotope Laboratories, DLM-1092), 5.625 μM ...
-
No products found
because this supplier's products are not listed.
Christian W. Johnson, et al.,
bioRxiv - Biochemistry 2021
Quote:
... GFP/Venus (MBL International, rat monoclonal, cat. # D153-3), GFP/Venus (Roche ...
-
No products found
because this supplier's products are not listed.
Amada M. Abrego, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Rats were induced with 3-4% isoflurane (SomnoSuite, Kent Scientific) and all whiskers on the right facial pad were trimmed except B1 ...
-
No products found
because this supplier's products are not listed.
Wei-Chun Chang, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... a cortisol ELISA kit (Salivary Cortisol Enzyme Immunoassay Kit, Salimetrics) was used according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Martineau Éric, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Muscles were incubated overnight at 4°C with a rat IgG2a anti-MAC-2 (Galectin-3) antibody (1:250; clone M3/38; Cedarlane, cat# CL8942AP), then 2h at RT with a rabbit IgG anti-S100β antibody (1:250 ...
-
No products found
because this supplier's products are not listed.
Francesco Borriello, et al.,
bioRxiv - Immunology 2020
Quote:
... rat anti-Dectin-2 (D2.11E4) was purchased from GeneTex; anti-phopsho-Syk (Tyr525/526 ...
-
No products found
because this supplier's products are not listed.
JM Robinson, et al.,
bioRxiv - Immunology 2019
Quote:
... I-FABP (Human I-FABP ELISA Kit, Hycult biotech, Cat# HK406), and LBP (Human Lipopolysaccharide Binding Protein ELISA Kit ...
-
No products found
because this supplier's products are not listed.
Joshua D. Powell, et al.,
bioRxiv - Microbiology 2024
Quote:
... ELISA (IDEXX) and HI assays were performed on serum from contact pigs at 17 dpc to determine if IAV-specific antibodies were present to indicate virus transmission.
-
No products found
because this supplier's products are not listed.
Harold P. Hodgins, et al.,
bioRxiv - Genomics 2022
Quote:
... VAMP1/2/3 (104102) were purchased from Synaptic Systems. Antibody against actin (AC-15 ...
-
No products found
because this supplier's products are not listed.
Marco Schade, et al.,
bioRxiv - Paleontology 2022
Quote:
... 2 & 3 (Figs. 1–3; Supplementary Figs. 1–4) was performed using a Metrotom 1500 (Carl Zeiss Microscopy GmbH, Jena, Germany) in a subsidiary of Zeiss in Essingen ...
-
No products found
because this supplier's products are not listed.
Felix Wagner, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Half medium was changed every 2-3 days using Xplorer multichannel pipettes (Eppendorf) set at lowest speed to not disturb the hostdonor interaction ...
-
No products found
because this supplier's products are not listed.
Gururaj Shivange, et al.,
bioRxiv - Biochemistry 2021
Quote:
... For coating 96-well ELISA plates (Olympus), the protein solutions (2μg/ml ...
-
No products found
because this supplier's products are not listed.
Rowena Hill, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... 2–5.5 µg of each sample was sheared using the Megaruptor 3 instrument (Diagenode, Liege, Belgium) at 18-20ng/µl and speed setting 31 ...
-
No products found
because this supplier's products are not listed.
Chen Liu, et al.,
bioRxiv - Cell Biology 2022
Quote:
... anti-rat (IRDye® 800 CW Goat anti-Rat IgG [H + L], LI-COR, 925-32219, 1:10.000) and anti-rabbit (IRDye ® 800 CW Goat anti-Rabbit IgG ...
-
No products found
because this supplier's products are not listed.
Chelsea D. Merkel, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Maximum projections of 2-3 um image stacks were created and deconvolved (3D Deconvolution) in NIS-Elements (Nikon) for presentation ...
-
No products found
because this supplier's products are not listed.
BL Spencer, et al.,
bioRxiv - Microbiology 2021
Quote:
EsxA sample purity was confirmed using tryptophan fluorescence (NanoTemper Tycho). Pure MBP was used as a negative control (sample impurity control ...
-
No products found
because this supplier's products are not listed.
VA Brentville, et al.,
bioRxiv - Immunology 2023
Quote:
... N protein was detected using the SARS-CoV-2 NP ELISA kit from Bioss (cat# BSKV0001) according to the supplier’s instructions ...
-
No products found
because this supplier's products are not listed.
Caleb R. Carr, et al.,
bioRxiv - Microbiology 2024
Quote:
... 2 µL of 10 µM 3’ PacBio round 2 reverse primer (PacBio_3pri_RND2), and 25 µL KOD Hot Start Master Mix ...
-
No products found
because this supplier's products are not listed.
Hanyuan Shen, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
A431 cells were treated with different injections for 48 hours in 96-well plates and the cell culture supernatant was collected and tested for the level of IL-1β by ELISA using human interleukin-1 beta ELISA kit (Biosensis, CA, USA) according to the kit protocol ...
-
No products found
because this supplier's products are not listed.
Jérôme Montnach, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Low resistance borosilicate glass pipettes (2-3 MΩ; Sutter Instruments) were filled with a solution containing (in mM) ...
-
No products found
because this supplier's products are not listed.
Sai Ambika Tadepalli, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Rats were ventilated with 3% isoflurane in 70% N2 and 30% O2 (Inspira ASV, Harvard Apparatus, Holliston, USA). Through the entire surgical procedure physiologic parameters (oxygen saturation (SpO2) ...
-
No products found
because this supplier's products are not listed.
Tim Nierhaus, et al.,
bioRxiv - Microbiology 2021
Quote:
... pooled and concentrated to 2-3 mg/ml using Vivaspin 15R concentrators (2 kDa MWCO HY, Sartorius). Small aliquots were flash-frozen in liquid nitrogen and stored at −80°C ...
-
No products found
because this supplier's products are not listed.
Christopher J. Black, et al.,
bioRxiv - Neuroscience 2023
Quote:
... A roughly ∼2-4mm craniotomy and 2-3 pilot holes were drilled using a micro drill (Stoelting). Stainless steel screws (000-120 ...
-
No products found
because this supplier's products are not listed.
Yahaya A. Yabo, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... an Opal 3-Plex Manual Detection Kit (Akoya Biosciences) was used following the manufacturer’s guidelines ...
-
No products found
because this supplier's products are not listed.
Kristina Vaeth, et al.,
bioRxiv - Biochemistry 2021
Quote:
... anti-rat-HRP (Dianova). All strains and plasmids used in this study are listed in Suppl ...
-
No products found
because this supplier's products are not listed.
Reimi Tada, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... they were immersed in 0.05% ethyl-3-aminobenzoate (Tokyo Chemical Industry, 886-86-2). When adult male frogs were sacrificed to excise their testes for transgenesis ...
-
No products found
because this supplier's products are not listed.
Sen Yang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... all culture medium was replaced by 2-3 ml of Hibernate E low fluorescence buffer (BrainBits) supplemented with 2mM GlutaMAX™ to maintain the ambient pH environment.
-
No products found
because this supplier's products are not listed.
Xi Chen, et al.,
bioRxiv - Bioengineering 2021
Quote:
PC12 cell or rat liver gDNAs was isolated using the TIANamp blood DNA kit (TIANGEN Biotech, DP304-02) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Paul McCusker, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 2 µL 1:1 diluted cDNA and SensiFAST SYBR No-ROX Kit (#BIO-98005, Bioline). Knockdown was assessed using ΔΔCt analysis as described by Pfaffl [92].
-
No products found
because this supplier's products are not listed.
Clara Taffoni, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... cGAMP enzyme-linked immunosorbent assay (ELISA) was performed according to the manufacturer’s protocol using the Cayman Chemical 2′3′-cGAMP ELISA Kit (Bertin Bioreagents).
-
No products found
because this supplier's products are not listed.
Hannah Donnelly, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Enzyme-linked immunosorbent assays (ELISA) was then carried out as per manufacturer’s instructions (R&D Systems, BMP-2 DuoSet ELISA kit, DY355). Briefly ...
-
No products found
because this supplier's products are not listed.
Halil Ibrahim Guler, et al.,
bioRxiv - Molecular Biology 2021
Quote:
ELISA KIT of COVID-19 spike protein:ACE-2 assay kit (Cat. No. 79954) was purchased from BPS Bioscience (79954), San Diego ...
-
No products found
because this supplier's products are not listed.
Eugene Kim, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and for acute phase protein α-2-macroglobulin using an ELISA kit (Life Diagnostics Inc., West Chester, USA).
-
No products found
because this supplier's products are not listed.
Seung-Eon Roh, et al.,
bioRxiv - Neuroscience 2023
Quote:
... CSF Orexin A was detected using a competitive ELISA Kit (Phoenix Pharmaceuticals) (Liguori et al ...
-
PhotoDextran® is 1 gram of lyophilized methacrylated dextran. PhotoDextran® provides 3D...
Cat# 5333-1KIT,
1 gram, USD $325.0
Ask
Nadab H. Wubshet, et al.,
bioRxiv - Cell Biology 2024
Quote:
... spheroids were encapsulated in collagen hydrogel consisting of 3 mg/mL rat-tail collagen (Advanced BioMatrix). The encapsulated spheroids were cultured in custom inserts fabricated by Space Tango ...
-
No products found
because this supplier's products are not listed.
Mariam Lotfy Khaled, et al.,
bioRxiv - Cancer Biology 2023
Quote:
3-methyl-2-oxovaleric acid sodium salt (KMV) (Toronto Research Chemical), 4-methyl-2-oxovaleric acid (KIC ...
-
No products found
because this supplier's products are not listed.
Dorothea O Tilley, et al.,
bioRxiv - Immunology 2021
Quote:
Immunising and screening peptides are outlined in S.Table 2 (Figure 3-figure supplement 2) and were synthesized by Eurogentec (Belgium). A portion was further conjugated to Key Lymphocyte Haemoglutinin (KLH ...
-
No products found
because this supplier's products are not listed.
Rebendenne Antoine, et al.,
bioRxiv - Microbiology 2020
Quote:
... Caco-2 and Calu-3 cells were obtained from American Type Culture Collection (ATCC); HEK-Blue™ IFN-α/β and IFN-γ cells were obtained from InvivoGen ...
-
No products found
because this supplier's products are not listed.
Oliver D Caspari, et al.,
bioRxiv - Plant Biology 2022
Quote:
... selected for Paromomycin resistance were grown in 200μl TAP in 96-well plates under 50μmol photons m-2 s-2 for 3-5 days and then screened for Venus expression in a fluorescence plate reader (CLARIOstar, BMG Labtech) as described previously (Caspari ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Lasse Kvich, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... filled to ∼1/3 volume with 2 and 0.1 mm diameter zirconia beads (Biospec, OK, USA) on ice ...
-
No products found
because this supplier's products are not listed.
Wei Liu, et al.,
bioRxiv - Bioengineering 2022
Quote:
Transfection of human pancreatic MIA PaCa-2 and BxPC-3 cells was performed with TransIT-mRNA (Mirus Bio) according to the manufacturer’s instructions ...