-
No products found
because this supplier's products are not listed.
Jin-Ran Chen, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Serum bone resorption marker C-terminal telopeptides of type I collagen (CTX-1) was measured by Rat-LapsTM ELISA from Nordic Biosciences Diagnostic (Herlev ...
-
No products found
because this supplier's products are not listed.
Lara N. Janiszewski, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Media with essentially no Zn was made by adding 3 µM 2-{[Bis(2-pyridinylmethyl)amino]ethylamino}benzenesulfonic (ZX1, an extracellular Zn chelator(61)) (Strem Chemicals, Inc.) to Chelex media ...
-
No products found
because this supplier's products are not listed.
Yuyan Cheng, et al.,
bioRxiv - Neuroscience 2020
Quote:
... cholera toxin B subunit (CTB, 3 µl/eye, 2 µg/µl, List Biological Laboratories, Inc., 103B) was injected intraocularly as an anterograde tracer to label axons regenerating through the optic nerve.
-
No products found
because this supplier's products are not listed.
Lei Li, et al.,
bioRxiv - Immunology 2021
Quote:
... with 1 or 5 μg rSp alone or mixed with either 1 mg Advax-SM adjuvant or where indicated 50 μg Al(OH)3 (2% Alhydrogel, Croda Denmark) in the thigh muscle at weeks 0 and 2 ...
-
No products found
because this supplier's products are not listed.
Campbell D. Lawson, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 10 nM leptomycin b, vehicle control or library compounds (Supplementary Tables 2, 3) were added using an Echo liquid handler (Labcyte/Beckman Coulter). Cells were incubated for a further 24 h then fixed in 4% paraformaldehyde and stained with DAPI and Alexa Fluor 488 Phalloidin (ThermoFisher) ...
-
No products found
because this supplier's products are not listed.
Armand O. Brown, et al.,
bioRxiv - Microbiology 2020
Quote:
... inflammatory chemokines and cytokines were additionally analyzed using a Mouse Cytokine ELISA Plate Array III Colorimetric Assay (Signosis). The data represent an average of at least 3 independent experiments for each strain and were analyzed using Student’s two-tailed t-test.
-
No products found
because this supplier's products are not listed.
Adam McNee, et al.,
bioRxiv - Immunology 2020
Quote:
... were coated with 2 μg/ml rec 2-12C (Absolute Antibody) in PBS-T overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Mehdi Zouiouich, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5’-AAC CGC AAT CAC ATC CAC GA-3’/5’-CAC CTC TGC CAT GAT CAC CG-3’) and the repair template (synthesized by ProteoGenix). The repair template was composed of two homology arms of 1000 bp flanking a puromycin resistance gene and mClover3 coding sequence separated by a P2A cleavage site ...
-
No products found
because this supplier's products are not listed.
Minh Dao Ngo, et al.,
bioRxiv - Immunology 2022
Quote:
... 3 mL aminopropyl SPE columns (Biotage; Charlotte, NC). The samples were dissolved in 1 ml of hexane and transferred to the SPE column ...
-
No products found
because this supplier's products are not listed.
Ian W. McCahill, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 2 media (Caisson Labs). Aqueous solutions of paclobutrazol and GA3 were freshly prepared and diluted to 0.1 µM and 10 µM respectively in hydroponic media ...
-
No products found
because this supplier's products are not listed.
Kristoffer Krogerus, Nils Rettberg, Brian Gibson,
bioRxiv - Microbiology 2022
Quote:
... after which spores from the different parental strains were dissected and placed next to each other on YPD agar plates (1 % yeast extract, 2 % peptone, 2 % glucose, and 2 % agar) using a micromanipulator (Singer Instruments, UK). The plates were incubated at 25 °C for 3 days ...
-
No products found
because this supplier's products are not listed.
Tomoya Niinae, Yasushi Ishihama,
bioRxiv - Biochemistry 2023
Quote:
... A coupling system using 1-((Dimethylamino)(dimethyliminio)methyl)-1H-[1,2,3]triazolo[4,5- b]pyridine 3-oxide hexafluorophosphate/N,N-diisopropylethylamine was employed for the introduction of F2Pmp (PEPTIDE INSTITUTE, INC., Osaka, Japan) and a coupling system using 1-hydroxybenzotriazole/2-(1H-Benzotriazole-1-yl)-1,1,3,3- tetramethyluronium hexafluorophosphat/N,N-diisopropylethylamine was employed for the introduction of all other amino acids and a biotin PEG2 acid (Broad Pharm ...
-
No products found
because this supplier's products are not listed.
Hannah Wapenaar, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and HRP conjugated secondary antibody, PonceauS (3% trichloroacetic acid, 3% sulfosalicylic Acid, 0.2% Ponceau) or stainfree gels (Mini-PROTEAN TGX Stain-Free Precast Gels).
-
No products found
because this supplier's products are not listed.
Yvan M. Vachez, et al.,
bioRxiv - Neuroscience 2020
Quote:
Mice were individually placed in a 30cm x 20cm behavioral arena (Lab Products Rat One Cage 2100™) and given 60 min/day to consume a highly palatable liquid (Nesquik® ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Katherine Williams, et al.,
bioRxiv - Genomics 2021
Quote:
... and 2% Ultrasor G (Crescent Chemical Co.). Day 0 cells were kept at low confluency to prevent spontaneous differentiation ...
-
No products found
because this supplier's products are not listed.
Gayani Wijegunawardena, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 2-chlorotrityl resin was purchased from Chempep Inc ...
-
No products found
because this supplier's products are not listed.
Marta Lopez-Nieto Jordana, et al.,
bioRxiv - Cell Biology 2023
Quote:
... expression levels of GADD34 in 2 control and 5 GADD34 KO single cell clones in response to 2 µM thapsigargin (Biotrend) treatment for 3 h was assessed by Western blotting ...
-
No products found
because this supplier's products are not listed.
Lauren Kane, et al.,
bioRxiv - Genetics 2021
Quote:
... and Chroma #89014ET (3 colour) or #89000ET (4 colour) single excitation and emission filters (Chroma Technology Corp., Rockingham, VT) with the excitation and emission filters installed in Prior motorised filter wheels ...
-
No products found
because this supplier's products are not listed.
Brynna S. Eisele, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The volume of concentrated samples was adjusted to 70 ul and 3 ul of Chondroitinase ABC (1.4 U/ml Stock solution, containing BSA, Seikagaku) was added to each sample ...
-
No products found
because this supplier's products are not listed.
Xiaoquan Zhu, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and concentrated using ViraTrap lentivirus purification kit (Biomiga). NIH3T3 or RWPE-1 cells or PC3 or LNCaP at 90% confluence were infected with Lenti-FOXP2 ...
-
No products found
because this supplier's products are not listed.
AR Wild, et al.,
bioRxiv - Neuroscience 2021
Quote:
The commercially available CAPTUREome S-palmitoylated protein kit (Badrilla, Leeds, UK) was used in accordance with the manufacturer’s guidelines with three optimizations ...
-
No products found
because this supplier's products are not listed.
Eun Jeong Lee, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Plasma ACTH concentrations were measured using the ACTH ELISA kit (MD Biosciences), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Jasmina Büchel, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and anti-O6-me-dG antibody (Squarix, EM 2-3, SQM003.1) were used in addition to Dynabeads™ Protein G for Immunoprecipitation (Invitrogen™ ...
-
No products found
because this supplier's products are not listed.
Robert J. Fialkowski, et al.,
bioRxiv - Physiology 2022
Quote:
Oxidative DNA damage was evaluated for 8-OhDG damage using a DNA damage ELISA kit (StressMarq Biosciences Inc.) (Fialkowski et al. ...
-
No products found
because this supplier's products are not listed.
Wedad Alhassen, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The slices were then incubated with rabbit anti-rat adenylate cyclase 3 (ADCY3, RPCA-ACIII; Encor Biotechnology, Alachua, FL, USA; 1:5000) and goat anti-human MCHR1 (goat anti-human MCHR1 ...
-
No products found
because this supplier's products are not listed.
Edward Sullivan, et al.,
bioRxiv - Microbiology 2021
Quote:
The BioSensor SARS-CoV-2 Ag Kit (Oxford Biosystems) was used in accordance with manufacturer’s instructions to process swab samples from hamsters ...
-
No products found
because this supplier's products are not listed.
Longhuan Ma, et al.,
bioRxiv - Immunology 2024
Quote:
... and blocked with 10% normal rat serum (Equitech-Bio) in PBS for 30 min ...
-
No products found
because this supplier's products are not listed.
Lisa Pomeranz, et al.,
bioRxiv - Bioengineering 2023
Quote:
ELISA plates were coated with 1µg/mL human spleen ferritin (Lee Biosolutions, MO) in PBS overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Yuko Ishida, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... rat anti-mouse F4/80 mAb (clone, BM8; BMA Biomedicals, Switzerland), rabbit anti-human CD3 pAbs ...
-
No products found
because this supplier's products are not listed.
Sang-Chul Kim, et al.,
bioRxiv - Biochemistry 2022
Quote:
... polyclonal anti-CCA1 (R1234-3, Abiocode), and polyclonal anti-histone H3 (A01502 ...
-
No products found
because this supplier's products are not listed.
William L. Brown, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... washed 3 times with CitrisolvTM (Decon Labs, #1601) or xylene for 5-min/each ...
-
No products found
because this supplier's products are not listed.
Li-Chun Cheng, et al.,
bioRxiv - Cell Biology 2023
Quote:
... rabbit anti-nesprin-3 (United States Biological Corporation), rabbit anti-myosin heavy chain (Abcam #124205) ...
-
No products found
because this supplier's products are not listed.
Livia Mazzini, et al.,
bioRxiv - Immunology 2020
Quote:
ELISA plates were coated with 1µg/mL of purified recombinant Spike S1 Protein (aa 18-676) (eEnzyme, Gaithersburg, MD, USA) or with 1µg/mL Spike-RBD (Arg319-Phe541 ...
-
No products found
because this supplier's products are not listed.
Jaqueline S. Generoso, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rabbit polyclonal anti-capsule serotype 3 antiserum (SSI Diagnostica) followed by Alexa Fluor 594 goat anti-rabbit (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
N.J.M van den Brink, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... and 60 % 3 D barrier medium (CELLnTEC, CnT–PR–3D)) and 24 hours afterwards the HEEs were lifted to the highest stand ...
-
No products found
because this supplier's products are not listed.
Sayf Al-deen Said, et al.,
bioRxiv - Pathology 2021
Quote:
Avant gauze non-woven gauze sponges 3”x3” (Medline, Cat. # NON21334)
-
No products found
because this supplier's products are not listed.
Shlomi Brielle, et al.,
bioRxiv - Cell Biology 2020
Quote:
Cells were seeded at 5,000 cells/cm2 density onto soft substrates with controlled elasticities (2 kPa and 25 kPa) composed of thin polyacrylamide hydrogel films and uniformly coated with rat-tail type-I collagen (Petrisoft; Matrigen). The hydrogels were coated with a 0.02 mg mL−1 rat tail type I collagen solution with a constant surface density.
-
No products found
because this supplier's products are not listed.
Morten Dencker Schostag, et al.,
bioRxiv - Microbiology 2019
Quote:
... Gas samples were transferred to 3-mL Exetainer vials (LABCO, Lampeter, UK) and analyzed using an autosampler (Mikrolab Aarhus ...
-
No products found
because this supplier's products are not listed.
Rita R. Fagan, et al.,
bioRxiv - Neuroscience 2020
Quote:
... mouse anti-SERT (ST51-2; Mab Technologies), rabbit anti-HA (C29F4 ...
-
No products found
because this supplier's products are not listed.
Rayan Khaddaj-Mallat, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 2% fetal bovine serum (FBS) (Wisent Bioproducts), and 1% penicillin/streptomycin (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Emilie Boucher, et al.,
bioRxiv - Immunology 2022
Quote:
... and OVA-dextramer (H-2 Kb) (Immudex) (Table S2).
-
No products found
because this supplier's products are not listed.
Melika Shahhosseini, et al.,
bioRxiv - Bioengineering 2022
Quote:
... supplemented with 2% heat-inactivated FBS (Atlas Biologicals), and 1mM MgCl2 ...
-
No products found
because this supplier's products are not listed.
Sangam Kandel, et al.,
bioRxiv - Genomics 2023
Quote:
... Samples were tested for the SARS-CoV-2 using the Aptima® SARS-CoV-2 (Panther® System, Hologic, San Diego, CA) nucleic acid amplification assay ...
-
No products found
because this supplier's products are not listed.
Kristen A. Gaffney, et al.,
bioRxiv - Biophysics 2021
Quote:
... iodoacetyl-7-nitrobenz-2-oxa-1,3-diazol (IA-NBD, Setareh Biotech) (42) ...
-
No products found
because this supplier's products are not listed.
Hiroshi Yamaguchi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Methylated gold nanoparticles (final 1:2 dilution; CGM2K-15-25, Cytodiagnostics) were added as fiducial markers ...
-
No products found
because this supplier's products are not listed.
Divine C. Nwafor, et al.,
bioRxiv - Neuroscience 2021
Quote:
... D3 cells were seeded onto 3 independent collagen-coated 16-well E-Plate PET arrays (ACEA Biosciences, San Diego, CA) at a concentration of 20,000 cells/well and loaded onto an xCelligence RTCA DP system (ACEA Biosciences ...
-
No products found
because this supplier's products are not listed.
A.J. Middleton, et al.,
bioRxiv - Biochemistry 2021
Quote:
... at 200:200 nL and 200:100 nL protein:well solution drop ratios in Swissci 3-well sitting drop plates using a mosquito (TTP Labtech). Diffraction-quality crystals of the UbV.k.2-Ube2k complex were produced in 0.2 M sodium citrate tribasic trihydrate ...
-
No products found
because this supplier's products are not listed.
Dani Flinkman, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and filtered through Whatman Grade 3 filter material and cleaned-up with C18-UltraMicroSpin columns (The Nest Group, Inc., Southborough, USA). The peptides were then dried and dissolved in 0.1 % Formic acid (FA) ...
-
No products found
because this supplier's products are not listed.
Amanda Thomaz, et al.,
bioRxiv - Cancer Biology 2019
Quote:
MB cells were seeded at density of 3×103 cells per well in complete medium into 96-well plates (NEST Biotechnology, Jiangsu, China). After overnight culture in complete medium ...