-
No products found
because this supplier's products are not listed.
Ankita Datey, et al.,
bioRxiv - Microbiology 2019
Quote:
The serum samples were also subjected to indirect ELISA to detect the presence of IgG antibodies against JEV using Porcine JE IgG ELISA Kit (Glory Science Co., Ltd, USA) in accordance with the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Aggeliki Tserga, et al.,
bioRxiv - Systems Biology 2021
Quote:
... Urinary albumin concentration was measured by ELISA using the AlbuWell kit (WAK-Chemie Medical GmbH, Steinbach, Germany). Urinary creatinine concentration was measured by the colorimetric method of Jaffe ...
-
No products found
because this supplier's products are not listed.
Filipy Borghi, et al.,
bioRxiv - Physiology 2021
Quote:
... 4 °C and analyzed using the commercial ELISA kit (Diagnostics Biochem Canada Inc. - Ref CAN-C-290) at the Laboratory of Stress Studies (LABEEST ...
-
No products found
because this supplier's products are not listed.
Simona Iftimie, et al.,
bioRxiv - Microbiology 2020
Quote:
... Tests were carried out with the VIASURE SARS-CoV-2 Real Time PCR Detection Kit that detects ORF1ab and N genes (CerTest Biotec, Zaragoza, Spain). RNA was extracted in a QIAcube apparatus with RNeasy reagents (Qiagen N.V. ...
-
No products found
because this supplier's products are not listed.
Katherine L. Leiby, et al.,
bioRxiv - Bioengineering 2022
Quote:
Primary rat lung microvascular endothelial cells (RLMVEC, VEC Technologies) were cultured on fibronectin (1 μg/cm2 ...
-
No products found
because this supplier's products are not listed.
Longhuan Ma, et al.,
bioRxiv - Immunology 2024
Quote:
... and blocked with 10% normal rat serum (Equitech-Bio) in PBS for 30 min ...
-
No products found
because this supplier's products are not listed.
Alexandra Turfe, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Rats were assigned to either a corticosterone (CORT; Lkt Laboratories) or a VEH group ...
-
No products found
because this supplier's products are not listed.
Junyu Yang, et al.,
bioRxiv - Cancer Biology 2020
Quote:
Pyrosequencing of the SALL4 gene in H661 cells was performed by EpigenDx, Inc ...
-
No products found
because this supplier's products are not listed.
Cise Kizilirmak, et al.,
bioRxiv - Systems Biology 2023
Quote:
The antisense oligos to target the Nfkbia gene were designed by Aum Biotech, LLC (Philadelphia ...
-
No products found
because this supplier's products are not listed.
Emilie Pondeville, et al.,
bioRxiv - Genetics 2019
Quote:
... Hemocytes were incubated at 4°C overnight with a rat anti-mCD8 antibody (Ancell) diluted 1:100 or a rabbit anti-PPO2 (Fraiture ...
-
No products found
because this supplier's products are not listed.
Kimberley El, et al.,
bioRxiv - Cell Biology 2023
Quote:
... levels were normalized to total protein levels (Sigma-Aldrich, #E3138, 1:1000 with Nacalai USA Signal Enhancer HIKARI), and total (i.e ...
-
No products found
because this supplier's products are not listed.
Daniela Fraccarollo, et al.,
bioRxiv - Immunology 2021
Quote:
... Serum samples were screened for CMV-specific IgG antibodies with the CMV-IgG-ELISA PKS Medac enzyme immunoassay (115-Q-PKS; Medac Diagnostika), using a cut-off value of >0.55 AU/mL for defining seropositivity according to manufacturer’s guidelines ...
-
No products found
because this supplier's products are not listed.
Donna Ye, et al.,
bioRxiv - Microbiology 2019
Quote:
... Media supplemented with milk protein (Hardy Diagnostics) was made by first sterilizing 2x media stocks (TSB or R2B ...
-
No products found
because this supplier's products are not listed.
Eric Waltari, et al.,
bioRxiv - Immunology 2019
Quote:
... Blocking solution (sciBLOCK Protein D1M solution, Scienion) was added at 200 μL/well with a multichannel pipet and allowed to incubate without agitation for 1 hour ...
-
No products found
because this supplier's products are not listed.
Li-Juan Zhang, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and PRRSV nucleocapsid protein (rabbit monoclonal, VMRD) antibodies were used to localize JEV ...
-
No products found
because this supplier's products are not listed.
Chun-Che Tseng, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Instant-Bands Protein Stain (EZBiolab, Parsippany, NJ) were used to visualize input and eluted material on a Typhoon FLA 7000 (GE Healthcare ...
-
No products found
because this supplier's products are not listed.
Raeann Goering, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... with protein ladder (Gel Company FPL-008). Gels were imaged with a Sapphire molecular imager (Azure Biosystems ...
-
No products found
because this supplier's products are not listed.
Cintia Horta, et al.,
bioRxiv - Cell Biology 2022
Quote:
... flies carrying an ectopic copy of the CAP-H2 gene and regulatory regions were produced by random P-element integration (Bestgene). Cap-H2 genomic region was amplified using 5’ GCATGAGCGGCCGCGGCGAA TCACTCACGATAGTG 3’ and reverse 5’ GCATGAGGTACCCACAAGA ACATGTGGGAGCTC 3 primers ...
-
No products found
because this supplier's products are not listed.
Koichi Sato, Aiko G.M. Hendrikx, Puck Knipscheer,
bioRxiv - Biochemistry 2023
Quote:
... The wild-type protein was overexpressed as a N-terminal His6-tagged protein in the E.coli JM109(DE3) cells (Intact Genomics) cultured in 4.4 L LB medium and purified by the previously described method53 ...
-
No products found
because this supplier's products are not listed.
Shlomi Brielle, et al.,
bioRxiv - Cell Biology 2020
Quote:
Cells were seeded at 5,000 cells/cm2 density onto soft substrates with controlled elasticities (2 kPa and 25 kPa) composed of thin polyacrylamide hydrogel films and uniformly coated with rat-tail type-I collagen (Petrisoft; Matrigen). The hydrogels were coated with a 0.02 mg mL−1 rat tail type I collagen solution with a constant surface density.
-
No products found
because this supplier's products are not listed.
Rebecca Kochanowsky, et al.,
bioRxiv - Microbiology 2022
Quote:
... Anti-Myc antibody (Protein Mods, Madison WI, USA) was used at 1:5,000 and the detecting anti-mouse antibody (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Stephan Brouwer, et al.,
bioRxiv - Microbiology 2020
Quote:
... The primary antibodies used for the detection of SpeC and SSA protein in GAS culture supernatants were rabbit antibody to SpeC (PCI333, Toxin Technology; 1:1,000 dilution) and affinity-purified rabbit antibody to SSA (produced by Mimotopes ...
-
No products found
because this supplier's products are not listed.
Kuan-Yi Lu, et al.,
bioRxiv - Microbiology 2020
Quote:
... fused to the re-codonized 3′ end of the gene (bp 1753–2034) and the target-specifying single guide RNA were synthesized on the BioXP™ 3200 (SGI-DNA) and cloned into pSN054 using the FseI/AsisI and AflII restriction sites ...
-
No products found
because this supplier's products are not listed.
Nicholai M. Hensley, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
... Varying volumes of concentrated protein solution and luciferin assay mix (Targeting Systems; prepared to manufacturer’s specifications but with unknown concentration for mammalian cells ...
-
No products found
because this supplier's products are not listed.
MaryAnn Martin, Irene L.G. Newton,
bioRxiv - Microbiology 2023
Quote:
Proteins were separated on 4-20% Tris-Glycine NB precast minigels (NuSep) and transferred to PVDF membrane in Tris-Glycine transfer buffer with 15% methanol at 40v on ice for 3 hours ...
-
No products found
because this supplier's products are not listed.
Hagit Hak, et al.,
bioRxiv - Plant Biology 2024
Quote:
... and images of protein bands were acquired and quantified using the Alliance Q9 software (UVITEC).
-
No products found
because this supplier's products are not listed.
Nicole Fazio, et al.,
bioRxiv - Biophysics 2023
Quote:
... ε260 = 8700 M− 1cm−1 for TMP) and ε260 = 4930 M−1 cm−1 for Cy3 and ε260 = 10000 M−1 cm−1 for Cy5 (Glen Research) based on the sequence of each DNA strand (Supplementary Table S1) ...
-
No products found
because this supplier's products are not listed.
A. C. Rothchild, et al.,
bioRxiv - Immunology 2019
Quote:
... and injecting 1 mL PBS using a 20G-1” IV catheter (McKesson) connected to a 1 mL syringe ...
-
No products found
because this supplier's products are not listed.
Juliana Bragazzi Cunha, et al.,
bioRxiv - Pathology 2021
Quote:
... 1 mM Copro-I (coproporphyrin-I dihydrochloride, Frontier Scientific, Catalog#:C654-1), vehicle or 0.2% calcein for 30min in the dark and vortexed every five minutes ...
-
No products found
because this supplier's products are not listed.
Federico Brandalise, et al.,
bioRxiv - Neuroscience 2023
Quote:
... TTX (1 µM; Latoxan), 4AP (100 µM ...
-
No products found
because this supplier's products are not listed.
Shoupeng Wei, et al.,
bioRxiv - Neuroscience 2023
Quote:
Hito Golgi-Cox Kit (Hitobiotec Corp., Wilmington, DE, USA) was used to reveal the structure and density of dendritic spines in the mPFC37–39 ...
-
No products found
because this supplier's products are not listed.
Madelon M.E. de Jong, et al.,
bioRxiv - Immunology 2023
Quote:
... slides were incubated with anti-human CD15 (1:10, C3D-1, Diagnostic BioSystems) for 1 hour at 37°C ...
-
No products found
because this supplier's products are not listed.
Elina Nagaeva, et al.,
bioRxiv - Neuroscience 2023
Quote:
... a 600- nl unilateral injection of 1:1 mixture of green retrobeads (1:10 dilution in dH2O, Lumafluor Inc., Durham, NC, USA) and pAAV2-hSyn-DIO-EGFP retrograde virus construct (7.6×1012 genome copies/ml ...
-
No products found
because this supplier's products are not listed.
Chanchal Thomas Mannully, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 1 μM PD0325901 (Biogems, Peprotech), mouse Leukemia inhibitory factor (LIF ...
-
No products found
because this supplier's products are not listed.
Alexandria J. Hammond, et al.,
bioRxiv - Microbiology 2020
Quote:
... followed by 1 hour with Spn typing sera (1:2000 dilution, SSI diagnostica, cat # 16913) and then 1 hour with goat-anti rabbit IgG conjugated to Alexa Fluor 594 (1:100 ...
-
No products found
because this supplier's products are not listed.
Takumi Koizumi, et al.,
bioRxiv - Biophysics 2024
Quote:
... cells expressing SNR-tagged proteins were simultaneously irradiated with light from a mercury lamp through a 540–580 nm bandpass filter (ET560/40x; Chroma Technology Corporation) and a 585 nm dichroic mirror (T585lpxr ...
-
No products found
because this supplier's products are not listed.
Saaz Sakrikar, Amy Schmid,
bioRxiv - Genomics 2021
Quote:
... 1 µg/mL mevinolin (AG Scientific) was added to liquid medium and 2.5 µg/mL to solid media to maintain selective pressure on the plasmid.
-
No products found
because this supplier's products are not listed.
Ilaria Frasson, et al.,
bioRxiv - Microbiology 2023
Quote:
... MKI-1 (ChemBridge, US, Cat: 9335496), Sulfasalazine (MedChemExpress at MedChemTronica EU ...
-
No products found
because this supplier's products are not listed.
C Kimberly Tsui, et al.,
bioRxiv - Cell Biology 2023
Quote:
... CSA (EY Laboratories, BA-3201-1), and SLBR-H and SLBR-N (made in-house in the Mahal Lab).
-
No products found
because this supplier's products are not listed.
Alicia Ravens, et al.,
bioRxiv - Neuroscience 2024
Quote:
... on coverslips (No. 1, Bioscience Tools) coated overnight with 0.2 mg/mL poly-L-lysine (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Jiyeon Choi, et al.,
bioRxiv - Genomics 2019
Quote:
... following the instructions of the Micellula DNA Emulsion & Purification Kit (EURx/CHIMERx). Amplified oligos were quantified using KAPA qPCR assay and verified by DNA sequencing on Ion PGM ...
-
No products found
because this supplier's products are not listed.
Rémi Veneziano, et al.,
bioRxiv - Immunology 2020
Quote:
... PEG3500 (#A4010-1/MAL-PEG3500-MAL) and PEG2000 (#A4010-1/MAL-PEG2000-MAL) bismaleimide were purchased from JenKem Technology.
-
No products found
because this supplier's products are not listed.
Jennifer D. Bowling, et al.,
bioRxiv - Microbiology 2019
Quote:
... using Vesphene IIse (diluted 1:128, Steris Corporation) for disinfection ...
-
No products found
because this supplier's products are not listed.
Sepiedeh Keshavarzi, et al.,
bioRxiv - Neuroscience 2021
Quote:
... submerged in 1 % Tergazyme (in distilled water, Alconox) for at least an hour ...
-
No products found
because this supplier's products are not listed.
Josh Jones, et al.,
bioRxiv - Microbiology 2023
Quote:
... 1 mM EDTA (Neta Scientific, QB-A611-E177-10), and 10% FBS (Avantor ...
-
No products found
because this supplier's products are not listed.
Clovis S Palmer, et al.,
bioRxiv - Immunology 2023
Quote:
... and samples oxidized with 1% Periodic Acid (Poly Scientific) for 10 minutes ...
-
No products found
because this supplier's products are not listed.
Jenny Vo, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The cells are lysed in a 2ml Eppendorf tube containing 1mL 0.5mm zirconia beads by vortexing for six cycles of 1 minute vortexing with 1 minute pauses using the Turbomix attachment on a Vortex Genie 2 (Scientific Industries Inc SKU: SI-0564) that had been pre-run at max speed for 1 minute preceding the vortexing to ensure consistent machine performance in the cold ...
-
No products found
because this supplier's products are not listed.
Yunqing Yu, et al.,
bioRxiv - Plant Biology 2024
Quote:
1% (w/v) methanolic uranyl acetate: Add 1g uranyl acetate (SPI Supplies, Cat ...
-
No products found
because this supplier's products are not listed.
CS Skoven, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 1 µm-thick sections were cut with an 8.0 mm diamond knife (Diatome Histo AT 110 ...
-
No products found
because this supplier's products are not listed.
Christian M. Smolko, Kevin A. Janes,
bioRxiv - Molecular Biology 2019
Quote:
... and the plate incubated for 1 hr at 37°C on a Jitterbug mixer (Boekel Scientific #130000) with mix setting set to 1 ...