Labshake search
Citations for AUM BioTech :
1 - 2 of 2 citations for Rat Macrophage expressed gene 1 protein MPEG1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2023Quote: The antisense oligos to target the Nfkbia gene were designed by Aum Biotech, LLC (Philadelphia ...
-
bioRxiv - Immunology 2022Quote: ... 2’-deoxy-2’-fluoro-D-arabinonucleic acid (2’-FANA) containing CTL ASOs targeting a Trypanosoma gene (GCCGTTTACGTCGTCACAGA) or Malat1 (TTCTTTGCCTATCTTGAATGC) were purchased from AUM BIOTECH and their purities were confirmed by MALDI ...