Labshake search
Citations for BestGene :
1 - 5 of 5 citations for Rat Macrophage expressed gene 1 protein MPEG1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... flies carrying an ectopic copy of the CAP-H2 gene and regulatory regions were produced by random P-element integration (Bestgene). Cap-H2 genomic region was amplified using 5’ GCATGAGCGGCCGCGGCGAA TCACTCACGATAGTG 3’ and reverse 5’ GCATGAGGTACCCACAAGA ACATGTGGGAGCTC 3 primers ...
-
bioRxiv - Neuroscience 2019Quote: ... The expression vectors containing the codon optimized TDP-43 gene were then microinjected into the flies to obtain transgenic flies (BestGene, Chino Hills, CA, USA). The expression of non-CO-TDP-43 is driven in the fly eye by the glass multimer reporter ...
-
bioRxiv - Physiology 2023Quote: ... and correctly assembled clones were midi-prepped using Qiagen kits and integrated into the genome at the attP2 third-chromosome site by BestGene, Inc (Chino Hills ...
-
bioRxiv - Neuroscience 2022Quote: ... and donor vector (400 ng μl-1) into {Act5C-Cas9.P.RFP-}ZH-2A w[118] Lig[169]flies was performed by BestGene Inc ...
-
bioRxiv - Cell Biology 2023Quote: ... The DNA plasmid of pScarlessHD-5’ msps homology arm-C-3xVHH05-6XMS2-DsRed-3’ msps homology arm was co-injected with pCFD5-gRNA#1 and pCFD5-gRNA#2 by BestGene. Flies with fluorescent red eyes were selected and crossed with Tub-PBac flies to remove the DsRed region by PBac transposase ...