-
No products found
because this supplier's products are not listed.
Lei Liu, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... H2A histone family member X (H2AX)(cat#7631S, Cell Signaling Technology, Boston, MA), phospho-histone H2AX (cat#9718S ...
-
No products found
because this supplier's products are not listed.
Jessica Gartrell, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... using a rabbit anti-SLFN11 (anti-Schlafen family member 11) polyclonal antibody (Sigma-Aldrich Cat# HPA023030, RRID:AB_1856613) (1:25 dilution ...
-
No products found
because this supplier's products are not listed.
Rui Xiao, et al.,
bioRxiv - Physiology 2019
Quote:
... PCR probe for Cela1 (chymotrypsin-like elastase family, member 1) was purchased from ThermoFisher (Applied Biosystems ...
-
No products found
because this supplier's products are not listed.
Jining Jia, et al.,
bioRxiv - Neuroscience 2020
Quote:
... solute carrier family 7 member 11 (SLC7A11) (rabbit, 55 kDa, ab175186, 1:5000, Abcam), Anti-5 Lipoxygenase (5-LOX ...
-
No products found
because this supplier's products are not listed.
Danielle L Blackwell, et al.,
bioRxiv - Developmental Biology 2021
Quote:
DNA was extracted from all family members from whole blood using Puregene chemistry (Qiagen). Exome capture was undertaken in both affected individuals using the SureSelect 50 Mb All Exon Kit v3 (Agilent ...
-
No products found
because this supplier's products are not listed.
Christina Pressl, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Solute Carrier Family 1 Member 3 (SLC1A3, Santa Cruz sc-515839 used at a concentration of 1:2000) ...
-
No products found
because this supplier's products are not listed.
Grant D. Jones, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Affinity-purified rabbit polyclonal antibodies specific to each eIF4E family member (Genscript) were used as the primary probe in western blotting ...
-
No products found
because this supplier's products are not listed.
Emma Bergsten, et al.,
bioRxiv - Microbiology 2023
Quote:
... and a 1:500 dilution of an antibody against the phosphorylated form of H2A histone family member X (γH2Ax) (clone JBW301, Merck) and 1:200 phalloidin coupled to Alexa Fluor 568 ...
-
No products found
because this supplier's products are not listed.
Kelly E. Leon, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Anti Ras (BD Transduction Laboratories ...
-
No products found
because this supplier's products are not listed.
Tricia T. Nguyen, Gia K. Voeltz,
bioRxiv - Cell Biology 2022
Quote:
... RA was PCR amplified from RA-NES (gift from R. Campbell, Addgene plasmid #61019) (Ding et al. ...
-
No products found
because this supplier's products are not listed.
Niccolò E. Mencacci, et al.,
bioRxiv - Genetics 2020
Quote:
... A genome-wide analysis genotyping scan was performed in all six members of family A and in the proband of family B using the HumanCytoSNP-12 DNA Analysis BeadChip Kit (Illumina, San Diego), according to manufacturer’s instruction ...
-
No products found
because this supplier's products are not listed.
Dan Song, et al.,
bioRxiv - Cancer Biology 2022
Quote:
RAS activity was analyzed with a Ras Activation Assay Biochem Kit (Cytoskeleton, BK008). The QGY cell lines containing the control group ...
-
No products found
because this supplier's products are not listed.
Shoko Miyata, et al.,
bioRxiv - Cell Biology 2020
Quote:
... p53 (MAb clone DO-1;IgG2a; Calbiochem (Oncogene Science) Ab6 ...
-
No products found
because this supplier's products are not listed.
Moon Hee Yang, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and immunoblotting was performed to detected GTP-bound Ras proteins using anti-K-Ras antibody (Proteintech, 12063-1-AP), anti-RasG12D mutant specific antibody (Cell Signaling Technologies [CST] ...
-
No products found
because this supplier's products are not listed.
Andrea Wetzel, et al.,
bioRxiv - Neuroscience 2023
Quote:
... TCF/LEF family antibody sampler kit (New England BioLabs), NFAT1 (New England BioLabs) ...
-
No products found
because this supplier's products are not listed.
Lorenz Thurner, et al.,
bioRxiv - Immunology 2021
Quote:
... rabbit IL-1-Ra antibody (antibodies-online # ABIN2856394) followed by anti rabbit/POX 1:3000 (Biorad#170-6515) ...
-
No products found
because this supplier's products are not listed.
Raquel Martinez-Curiel, et al.,
bioRxiv - Neuroscience 2023
Quote:
... member 3A (Wnt3A) (10 ng/mL, R&D Systems) and cyclopamine (1 μM ...
-
No products found
because this supplier's products are not listed.
Alon Wellner, et al.,
bioRxiv - Bioengineering 2020
Quote:
A computationally designed 200,000-member naïve nanobody CDR3 library was synthesized as an oligonucleotide pool of CDR3 sequences by Agilent, as previously reported (29) ...
-
No products found
because this supplier's products are not listed.
Abigael Cheruiyot, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Activity of the SMG1i against other PI3 kinase family members (PI3Kα, PI3Kβ, PI3Kγ, PI3Kδ, MTOR) was evaluated using Amplified Luminescent Proximity Homogeneous Assay (Alpha) Screen assays (Perkin Elmer and Echelon Biosciences). PI3K or mTOR protein (produced in Sf9 cells ...
-
No products found
because this supplier's products are not listed.
Liping Zeng, et al.,
bioRxiv - Immunology 2022
Quote:
... The members were visualized on X-ray films or ChemiDoc Imaging System (BioRad, Hercules, CA) following the reaction with the enhanced chemiluminescence substrate (SuperSignal™ West Pico PLUS Chemiluminescent Substrate ...
-
No products found
because this supplier's products are not listed.
Hari Krishnamurthy, et al.,
bioRxiv - Immunology 2022
Quote:
The RA panel included anti-RF IgM (Roche Diagnostics ...
-
No products found
because this supplier's products are not listed.
Lydia M. Castelli, et al.,
bioRxiv - Systems Biology 2021
Quote:
... All-Trans Retinoic Acid 0.1 µM (RA; StemCell Technologies) and Purmorphamine 0.5 µM (PMN ...
-
No products found
because this supplier's products are not listed.
Philippe F.Y. Vincent, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the Basic Helix-Loop-Helix Family Member BHLHB5 Cre mice (Bhlhb5Cre/+29,30) crossed with homozygous floxed Ai9 mice (Ai9fl/fl; Td-Tomato, Jackson Laboratory #007905) and 3 ...
-
No products found
because this supplier's products are not listed.
Farshad Farshidfar, et al.,
bioRxiv - Cancer Biology 2021
Quote:
The amount of GTP-bound RAS was determined using the Ras GTPase Chemi ELISA Kit (Active Motif North America ...
-
No products found
because this supplier's products are not listed.
Lu Han, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... 2uM RA+ 2uM PMA (Tocris) is used for 2 days ...
-
No products found
because this supplier's products are not listed.
Deanna Tiek, et al.,
bioRxiv - Cancer Biology 2022
Quote:
The CLK family of nanoBRET assays were run as directed by Promega. Briefly ...
-
No products found
because this supplier's products are not listed.
Michael J. D. Daniels, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Antibodies (BioLegend) used were as follows:
-
No products found
because this supplier's products are not listed.
Toshiya Kimura, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... and detected with a CCD imager (RAS-4000; GE healthcare). The following primary antibodies were used ...
-
No products found
because this supplier's products are not listed.
Eric W. Fowler, et al.,
bioRxiv - Bioengineering 2021
Quote:
Expression of TGF-β family members was investigated using a Human TGF beta Array C2 (AAH-TGFB-2-2; RayBiotech®, Peachtree Corners, GA). Medium collected from hydrogel cell constructs from days 3-6 was pooled from three biological replicates and used to carry out the assay following the manufacturer’s procedure ...
-
No products found
because this supplier's products are not listed.
Fathima Athar, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Fibroblasts stably expressing oncogenes or a combination of oncogenes were tested for tumor formation in nude mice (Charles River, Crl :NIH-Lystbg-JFoxn1nuBtkxid). Each flank of the nude mice was injected with two million cells in 100 μL PBS mixed with an equal volume of Matrigel using a 22-gauge needle ...
-
No products found
because this supplier's products are not listed.
Baptiste Fischer, et al.,
bioRxiv - Bioengineering 2023
Quote:
... RAS loaded with mant•GDP (RAS•mGDP) was obtained by mixing RAS with a 10x stochiometric excess of mGDP (Jena Bioscience) in a buffer containing an excess (20 mM ...
-
No products found
because this supplier's products are not listed.
Megan E. Honeywell, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and Puromycin (#61-385-RA) was purchased from Corning. Pooled siGENOME siRNAs were purchased from Dharmacon/Horizon Discovery ...
-
No products found
because this supplier's products are not listed.
Nadine Kabbani, et al.,
bioRxiv - Neuroscience 2021
Quote:
... primary antibody and HRP secondary antibody (Jackson ImmunoResearch). SeeBlue protein was used as a molecular weight marker ...
-
No products found
because this supplier's products are not listed.
Leelavathi N Madhu, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Ras (MyBioSource), p38 MAPK (Cell Signaling ...
-
No products found
because this supplier's products are not listed.
Allison Knupp, et al.,
bioRxiv - Cell Biology 2020
Quote:
... The following primary antibodies were used: Ras-related protein Rab-5A (RAB5A) at 1:500 (Synaptic Systems 108 011); early endosome antigen 1 (EEA1 ...
-
No products found
because this supplier's products are not listed.
Takehiro Takahashi, et al.,
bioRxiv - Neuroscience 2021
Quote:
The 5’UTR promoter region of mouse L1Spa belonging to LINE-1 Tf family was amplified with the primers (Fw; AATGGGCAGAGCTCGTTTAG, Rv: CTGGTAATCTCTGGAGTTAG) and Takara LA Taq polymerase with GC buffer (Takara Bio) using pTN201 plasmid (a kind gift from Dr ...
-
No products found
because this supplier's products are not listed.
Michelle S Glossop, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... NUDT16L1 antibody (Atlas Antibodies) and CRM1 antibody (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Jeremy R. Egbert, et al.,
bioRxiv - Cell Biology 2019
Quote:
... antibody binding was detected using fluorescent secondary antibodies (LI-COR Biosciences ...
-
No products found
because this supplier's products are not listed.
Fransenio Clark, et al.,
bioRxiv - Immunology 2022
Quote:
The TCR V beta repertoire kit contained antibodies to over 76% of V βeta families (Beckman Coulter, Fullerton, CA). The cells were stained with these antibodies in combination with tetramers or dextramers for 20 minutes at RT to determine the TRBV repertoire of antigen specific cells ...
-
No products found
because this supplier's products are not listed.
Alexandra Blanco, et al.,
bioRxiv - Microbiology 2024
Quote:
... or 1μM retinoic acid (RA; Cayman Chemicals) + 1μM VitD for 72h as previously described (38 ...
-
No products found
because this supplier's products are not listed.
Kazuki Hattori, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... with a digital microscope camera (RA-MC120HD, Leica). The medium of the brown adipocytes was replaced with basal culture medium (high-glucose DMEM containing 20% FBS ...
-
No products found
because this supplier's products are not listed.
Chaochao Dai, et al.,
bioRxiv - Immunology 2024
Quote:
... anti-TNFSF9 (tumor necrosis factor superfamily member 9) (#bs-3851R-APC) was from Bioss (Beijing, China); anti-interleukin (IL)-1β (#12-7018-41 ...
-
No products found
because this supplier's products are not listed.
Rajika Arora, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Probe specific for Tf L1 family was labeled with Red-dUTP (Enzo Life sciences) using a nick translation kit (Abbot) ...
-
No products found
because this supplier's products are not listed.
M. Bell, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Differentiation with RA & the brain-derived neurotrophic factor (BDNF, Peprotech) was adapted from former protocols56 ...
-
No products found
because this supplier's products are not listed.
Hongyi Wu, et al.,
bioRxiv - Cell Biology 2024
Quote:
... NM + 1 μM RA + 1 μΜ Purmorphamine (Miltenyi Biotec 130-104-465), was added and changed every other day until D17 ...
-
No products found
because this supplier's products are not listed.
Tom Bonnifet, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Primary antibodies (ORF1p antibody: abcam ab216324; NeuN antibody: GeneTex GTX00837) were diluted (1/200 and 1/500 respectively ...
-
No products found
because this supplier's products are not listed.
Hojin Lee, Tae-Hyeon Kim, Joo-Yeon Yoo,
bioRxiv - Cell Biology 2022
Quote:
Antibodies: hCdc73 antibody (Bethyl, a300-170a) was used for immunoblotting and IP ...
-
No products found
because this supplier's products are not listed.
Brian Olson, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... anti-CD4 antibody and anti-CD8 antibodies (BioXCell, Lebanon ...
-
No products found
because this supplier's products are not listed.
Jennifer S. Lanni, et al.,
bioRxiv - Genetics 2019
Quote:
... primary antibody (KCC4/SLC12A7 rabbit polyclonal antibody, Novus Biologicals NBP1-49583) was added at 1:100 dilution in PBST (1% goat serum ...
-
No products found
because this supplier's products are not listed.
Angelica M. Riojas, et al.,
bioRxiv - Genomics 2021
Quote:
... All primary antibodies utilized a biotinylated secondary antibody from Vector Laboratories (Burlingame ...