Labshake search
Citations for Agilent :
1 - 50 of 1787 citations for RAB41 Member RAS Oncogene Family RAB41 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: A computationally designed 200,000-member naïve nanobody CDR3 library was synthesized as an oligonucleotide pool of CDR3 sequences by Agilent, as previously reported (29) ...
-
bioRxiv - Genomics 2020Quote: ... III14 and IV9 in this family by using SureSelect Human All Exon Kit (Agilent, Santa Clara, CA) to capture the exome and HiSeq2000 platform (Illumina ...
-
bioRxiv - Cell Biology 2020Quote: To identify the causative mutation in these families we sequenced the whole exome of the affected individuals with the SureSelect human AllExon 50Mb kit (Agilent Technologies) and sequenced on the HiSeq 2500 (Illumina ...
-
bioRxiv - Cancer Biology 2019Quote: Site-directed mutagenesis to generate the mutant RAS clones was performed with a QuikChange mutagenesis kit (Stratagene) and the primers for amino acid 180 site mutation of KRAS4A are CAGCAAAGAAGAAAAGACTCCTGGCAGTGTGAAAATT and AATTTTCACACTGCCAGGAGTCTTTTCTTCTTTGCTG.
-
bioRxiv - Genetics 2024Quote: ... Whole exome sequencing was performed on genomic DNA extracted from the peripheral lymphocytes of the patients and their families using the SureSelect Human All Exon Kit V6 (Agilent Technologies, Santa Clara, CA, USA) with sequencing on the NovaSeq 6000 platform (Illumina ...
-
bioRxiv - Cancer Biology 2022Quote: ... All K-Ras secondary mutant and wild-type K-Ras constructs were generated by a PCR based strategy using a site-directed mutagenesis kit (Stratagene) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... and 0.1 g samples were then used to measure RA and SAB contents by high-performance liquid chromatography-tandem mass spectrometry as reported previously (Agilent 1200, USA)(Zhou et al. ...
-
bioRxiv - Pathology 2020Quote: ... Antibodies were diluted in antibody diluent (Dako). Immunostained samples were analyzed with a fluorescence microscope (Olympus DP72) ...
-
bioRxiv - Cell Biology 2023Quote: ... primary antibodies prepared in antibody diluent (Agilent) were added for 8 hours at room temperature ...
-
bioRxiv - Bioengineering 2021Quote: ... All antibodies were diluted in Dako Antibody Diluent (Dako Antibody Diluent S0809; Agilent Technologies). Images were captured by confocal microscopy (Leica DMi8 ...
-
bioRxiv - Neuroscience 2020Quote: ... Primary antibodies were diluted in antibody diluent (Dako) and applied for 45 minutes at room temp ...
-
bioRxiv - Physiology 2022Quote: ... Primary antibodies were diluted in antibody diluent (Dako) and incubated overnight at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... Primary antibodies were diluted in Antibody Diluent (Dako) and a droplet of 25 µl or 50 µl applied on the sample for an 8-well or a coverslip upside down ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primary antibodies were diluted in Antibody Diluent (Dako) and incubated overnight at 4 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... Antibodies were diluted in antibody diluent (Dako, S0809) containing 0.3% Triton X-100 and incubated overnight at 4 °C in a humidified chamber ...
-
bioRxiv - Cancer Biology 2021Quote: Antibodies were diluted in antibody diluent (Dako, S302281-2). Nuclei were visualized by DAPI (Sigma ...
-
bioRxiv - Cancer Biology 2019Quote: ... All antibodies were prepared in antibody diluent from Dako envision kit ...
-
bioRxiv - Immunology 2022Quote: ... Antibodies were diluted in Background Reducing Antibody Diluent (Agilent). The tissue was subsequently incubated with an anti-rabbit HRP polymer (Leica ...
-
bioRxiv - Bioengineering 2021Quote: ... All antibodies were diluted in Dako Antibody Diluent (Dako Antibody Diluent S0809 ...
-
bioRxiv - Immunology 2021Quote: ... Antibodies were diluted in Background Reducing Antibody Diluent (Agilent). The tissue was subsequently incubated with an anti-rabbit HRP polymer (Leica ...
-
bioRxiv - Microbiology 2022Quote: ... primary antibodies and appropriate HRP-conjugated secondary antibodies (DAKO). A chemiluminescence substrate (West Dura ...
-
bioRxiv - Cancer Biology 2023Quote: ... Primary antibodies were diluted in antibody diluent (Agilent; #S3022) and incubated with sections for 16 hours at 4 °C ...
-
bioRxiv - Immunology 2023Quote: ... antibodies were diluted in Background Reducing Antibody Diluent (Agilent) and subsequently incubated with an anti-rabbit HRP polymer (Leica ...
-
bioRxiv - Neuroscience 2023Quote: ... Primary antibodies diluted in antibody diluent (S080983-2, Dako) were applied on sections for overnight at 4°C ...
-
bioRxiv - Cancer Biology 2019Quote: ... Antibody dilutions were prepared in antibody diluent (Agilent, London, UK). The primary antibodies and concentrations used are as follows ...
-
bioRxiv - Cancer Biology 2021Quote: ... Antibodies were diluted in Dako Real Antibody Diluent (Dako, S2022). Staining was performed on the BenchMark XT immunostainer (Ventana Medical Systems).
-
bioRxiv - Developmental Biology 2022Quote: ... Primary antibodies were diluted in Dako antibody diluent (S0809, Dako) and incubated on sections overnight at 4°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... Primary antibodies were diluted in Dako antibody diluent (S0809, Dako) and incubated overnight at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: Anti-iba1 microglial antibody (AlphaLaboratories) or anti-GFAP antibody (Agilent) were used with biotinylated polyclonal goat anti-rabbit immunoglobulin secondary antibodies (Dako ...
-
bioRxiv - Cancer Biology 2024Quote: ... primary antibodies were typically diluted in antibody Diluent (DAKO, S2022) with 2% milk (v/v ...
-
bioRxiv - Physiology 2019Quote: ... Secondary antibodies (Dako) anti-mouse ...
-
bioRxiv - Biochemistry 2020Quote: ... Antibodies: Ubiqutin (Dakocytomation); Cdc53/yCul1 (Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2019Quote: ... Secondary antibodies (Dako Donkey anti-goat P0449 ...
-
bioRxiv - Developmental Biology 2023Quote: ... CD3 antibody (Dako M725429-2 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Primary antibodies were probed using species-specific HRPconjugated secondary antibodies (Dako) and viewed using a Chemidoc imager (BioRad).
-
bioRxiv - Cancer Biology 2022Quote: ... All primary antibodies were diluted with Antibody Diluent (Dako, Hamburg, Germany) and incubated for 1 hour at RT ...
-
bioRxiv - Immunology 2022Quote: ... and rabbit anti-LC3B (1:1000) antibodies in Antibody Diluent (Dako) as primary antibodies ...
-
bioRxiv - Neuroscience 2022Quote: ... The primary antibody was diluted in antibody diluent (S080983-2, Dako) and applied for 60 minutes at room temperature (RT) ...
-
bioRxiv - Microbiology 2023Quote: ... monoclonal antibody combined with rabbit anti-mouse-HRP polyclonal antibodies (DAKO). Signals were detected by use of enhanced chemiluminescence (ECL ...
-
bioRxiv - Immunology 2023Quote: ... The primary antibodies used were anti-lysozyme antibody (Abcam, and Dako) and Ki67 (Cell Signaling Technology) ...
-
bioRxiv - Cell Biology 2023Quote: ... prior to incubation with antibodies in Dako antibody diluent (Agilent Technologies) overnight at 4°C in a humidified chamber with the following primary antibodies ...
-
bioRxiv - Cell Biology 2024Quote: Secondary antibodies: Peroxidase-conjugated goat anti-mouse IgG antibody (Dako #P0447) (1:2000) ...
-
bioRxiv - Cell Biology 2020Quote: ... prior to incubation with antibodies in Dako antibody diluent (Agilent technologies S3022). Antibodies and the corresponding dilutions used are listed as follows ...
-
bioRxiv - Biochemistry 2019Quote: ... The antibodies used were the polyclonal rabbit anti-human β2M antibody (Dako) (used at 1/1000) ...
-
bioRxiv - Neuroscience 2021Quote: ... All blocking and antibody dilutions were prepared in Dako antibody diluent (Agilent). After three wash steps in TBS ...
-
bioRxiv - Neuroscience 2021Quote: ... Gap43 antibodies were visualized with biotin-conjugated rabbit anti-mouse antibodies (Dako) followed by streptavidin-conjugated Cy3 (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Primary antibodies were detected using biotinylated IgG secondary antibodies (Agilent, 1:400), using streptavidin-HRP (Agilent ...
-
bioRxiv - Cancer Biology 2021Quote: ... The anti-CD8 antibody (1:5,000, C8/144B, mouse monoclonal antibody, Agilent) was detected using the Opal 520 fluorophore (1:150 ...
-
bioRxiv - Neuroscience 2019Quote: ... Primary antibodies were detected using horseradish peroxidase (HRP)-conjugated secondary antibodies (Dako) and chemiluminescent reagent (Thermo Scientific) ...
-
bioRxiv - Neuroscience 2021Quote: ... we used the following antibodies: total pan-Tau antibody K9JA (Dako, A0024), β-Actin loading control monoclonal antibody (BA3R ...