-
No products found
because this supplier's products are not listed.
Nicole L. Welch, et al.,
bioRxiv - Microbiology 2020
Quote:
... Marbled eel adomavirus virions were purified from lysates of infected EK-1 cells using Optiprep gradient ultracentrifugation (Peretti, FitzGerald et al. 2015). DNA extracted from Optiprep gradient fractions was subjected to rolling circle amplification (RCA ...
-
No products found
because this supplier's products are not listed.
Denisa Bojkova, et al.,
bioRxiv - Microbiology 2022
Quote:
... H1N1 (Influenza A Virus) Nucleoprotein (Bioss, #bs-4976R, 1:4000), ISG15 (Santa Cruz Biotechnology ...
-
No products found
because this supplier's products are not listed.
Hilda Mirbaha, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Lysate was homogenized by GEA Niro Soavi’s PandaPLUS 2000 ...
-
No products found
because this supplier's products are not listed.
Subeena Sood, et al.,
bioRxiv - Immunology 2023
Quote:
... A fixed concentration of SARS-CoV-2 GFP pseudotyped virus (BPS Biosciences) was added and the plate incubated for 60 minutes at 37°C and 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Jieqiong Qu, et al.,
bioRxiv - Microbiology 2023
Quote:
... CHIKV virus stock (5 × 108 TCID50/mL) and full human blood (Sanquin) was 1:2 mixed to make the infectious blood meal with a final virus titer of 1.7× 108 TCID50/ml ...
-
No products found
because this supplier's products are not listed.
Leena Hussein Bajrai, et al.,
bioRxiv - Microbiology 2021
Quote:
... the plates were analyzed by observing virus-induced CPE by light microscope (Nikon-ECLIPSE-Ti), and plaque formation was determined by crystal violet staining (C0775 ...
-
No products found
because this supplier's products are not listed.
Teresa R. Wagner, et al.,
bioRxiv - Immunology 2023
Quote:
... purified antigen (Acrobiosystems) was reacted with Sulfo-NHS-LC-LC-Biotin (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Jie Dong, et al.,
bioRxiv - Plant Biology 2020
Quote:
... The lysate was filtered through a 30 μm mesh (Sysmex Partec). Propidium iodide (Sigma ...
-
No products found
because this supplier's products are not listed.
Han Sun, et al.,
bioRxiv - Microbiology 2023
Quote:
... Lysates were then injected with 40 µl firefly luciferin substrate (Biosynth) and luminescence was measured using a SpectraMax L plate reader (Molecular Devices).
-
No products found
because this supplier's products are not listed.
Gila Lustig, et al.,
bioRxiv - Microbiology 2019
Quote:
... Supernatant containing released virus was harvested two days post-transfection and filtered through a 0.45 micron filter(GVS) and stored in 0.5ml aliqouts at −80°C ...
-
No products found
because this supplier's products are not listed.
Jun Zhang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Whole-cell lysates (200 μg protein/sample) were incubated with UbiQapture-Q Matrix (Biomol) by gentle agitation at 4°C overnight to pull down all ubiquitinated proteins according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Susanne Gaul, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... The vector particles were purified using an iodixanol (Progen, Germany) gradient consisting of four phases with decreasing density (60% ...
-
No products found
because this supplier's products are not listed.
Alessia Landi, et al.,
bioRxiv - Cell Biology 2019
Quote:
... LecB was further purified using an endotoxin removal column (Hyglos) and a LAL chromogenic endotoxin quantitation kit (Thermo Scientific ...
-
No products found
because this supplier's products are not listed.
Daniel Duzdevich, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... The oligo was then purified with a GlenPak (Glen Research) using Norm-Ject® syringes (Air-Tite) ...
-
No products found
because this supplier's products are not listed.
Holly Matthews, et al.,
bioRxiv - Microbiology 2021
Quote:
... Gametocytes were purified using prewarmed 55% Nycodenz (Alere Technologies AS) in RPMI from 100% stock (Nycodenz 27.6% (w/v) ...
-
No products found
because this supplier's products are not listed.
Shu Liu, et al.,
bioRxiv - Neuroscience 2022
Quote:
... goat anti- xenotropic MLV virus antibody ABIN457298 (1:1000, antibodies-online); mouse anti- MLV gag ab100970 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Rueyhung R. Weng, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... 5% human platelet lysate (PLS1, Compass Biomedical), 70 ng/mL IL-15 (AF-200-15 ...
-
No products found
because this supplier's products are not listed.
Youssouf Sereme, et al.,
bioRxiv - Microbiology 2020
Quote:
... A poliovirus serology-positive control serum (Poliomyelitis virus kit, GenWay, San Diego, California, USA) was also used as a control ...
-
No products found
because this supplier's products are not listed.
Susan A. Leonhardt, et al.,
bioRxiv - Biophysics 2022
Quote:
... virus-containing supernatants were filtered and placed in poly-lysine-coated glass-bottom dishes (MatTek). Particles were then washed and stained with Alexa594-annexin V (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Taeyong Kwon, et al.,
bioRxiv - Microbiology 2022
Quote:
... The same amount of the virus was mixed with 45 µL of human saliva (Lee Biosolutions) or medium and transferred into a 2 mL tube or onto stainless steel in the 12-well plate ...
-
No products found
because this supplier's products are not listed.
Daniela Niemeyer, et al.,
bioRxiv - Microbiology 2021
Quote:
... and B.1.351 was assessed by a surrogate virus neutralization test (cPass Assay, Medac, Wedel, Germany) as described previously (Momsen Reincke et al. ...
-
No products found
because this supplier's products are not listed.
Susanne A. Wycislo, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Equivalent amounts of “light”-labeled control and “heavy”-labeled GFP–containing lysates or “light”-labeled control and “heavy”-labeled GFP–containing lysates were incubated (separately) with GFP-Trap agarose beads (Allele Biotechnology, San Diego, CA) for 30 min at 4°C ...
-
No products found
because this supplier's products are not listed.
Lisa-Marie Kuhl, et al.,
bioRxiv - Genetics 2020
Quote:
... Cell lysates were mixed on a VXR basic Vibrax (IKA) for 2 min at 1500 rpm ...
-
No products found
because this supplier's products are not listed.
Anna Fortuny, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Lysates were homogenised with a tight Dounce homogeniser (DWK Life Sciences) and nuclei were collected by centrifugation ...
-
No products found
because this supplier's products are not listed.
Michael G. Spelios, et al.,
bioRxiv - Immunology 2021
Quote:
... purified His-tagged ACE2 (EpiGentek) was added at a concentration of 100 ng/well (prepared with PBS ...
-
No products found
because this supplier's products are not listed.
Ankita Deo, et al.,
bioRxiv - Genetics 2023
Quote:
... Anti-GFP purified antibody (Elabscience) was added to the beads (1:1000 ...
-
No products found
because this supplier's products are not listed.
Milène Vandal, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The lysate was incubated with 100 U/mL salt-active nuclease (Arcticzymes) at 37°C for 1 h and then centrifuged at 2000 xg for 15 min ...
-
No products found
because this supplier's products are not listed.
Michael D. Vahey, Daniel A. Fletcher,
bioRxiv - Microbiology 2019
Quote:
... replacing media with virus growth media supplemented with or without a specified concentration of oseltamivir carboxylate (Toronto Research Chemicals O700980), but without TPCK-treated trypsin ...
-
No products found
because this supplier's products are not listed.
Avital Licht-Murava, et al.,
bioRxiv - Neuroscience 2022
Quote:
... per ml culture medium at DIV 8 using Lipofectamine 3000 5 h before infection with vesicular stomatitis virus (VSV) at 100 MOI or with adenovirus-eGFP (Ad5CMV-eGFP, lot #ad3586, Viral Vector Core Facility, Carver College of Medicine ...
-
No products found
because this supplier's products are not listed.
Sara Al Rawi, et al.,
bioRxiv - Neuroscience 2021
Quote:
Fbxo7 was immunoprecipitated from cell lysates using 2μl of anti-Fbxo7 antibody (Aviva), or isotype matched control ...
-
No products found
because this supplier's products are not listed.
Jay Leipheimer, et al.,
bioRxiv - Microbiology 2019
Quote:
Whole-cell lysate from yeast cultures was obtained by glass bead((#9831 RPI) mediated mechanical disruption using Bullet Blender Gold (Next Advance Model:BB2U-AU ...
-
Cat# ZK312-1,
USD $795.0/mg
Ask
Milica Moskovljevic, et al.,
bioRxiv - Immunology 2024
Quote:
... Cells stimulated with either lysates of CMV-infected fibroblasts (Virusys, 10 μg/mL), overlapping Gag 15mer peptides (HIV-1 Gag peptide pool ...
-
No products found
because this supplier's products are not listed.
Timothy F. Shay, et al.,
bioRxiv - Bioengineering 2023
Quote:
... The resulting lysate was extracted from an iodixanol (Cosmo Bio USA, OptiPrep, AXS-1114542) step gradient following ultracentrifugation ...
-
No products found
because this supplier's products are not listed.
Matilda Shackley, et al.,
bioRxiv - Cell Biology 2020
Quote:
... IP1 concentrations were measured from cell lysates using the HTRF IP-One immunoassay kit (CisBio). Fluorescence was measured and IP1 levels were quantified using the same methodology as the cAMP assay.
-
No products found
because this supplier's products are not listed.
Paola Munoz-Tello, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... using a pET-46 tobacco etch virus (TEV) protease-cleavable N-terminal hexahistidine tag fusion protein in M9 media supplemented with 15NH4Cl (Cambridge Isotope Labs, Inc.). Nurr1 LBD was eluted against a 500 mM imidazole gradient through a Ni-NTA column ...
-
No products found
because this supplier's products are not listed.
Wenhui Qiao, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Aβ oligomers in TBS and TBSX lysates were detected by commercial kits (Biosensis, BEK-2215-2P). sAPPa ...
-
No products found
because this supplier's products are not listed.
Anja Konietzny, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Lysates were then analyzed by PCR with corresponding primers and Econo Taq PLUS Green Mix (Euromedex). Primers pairs for testing TTL mouse strain were 5’GGCGACTCCATGGAGTGGTGG and 5’CCCAACATCACATTCTCCAAATATCAAAG (TTL wildtype ...
-
No products found
because this supplier's products are not listed.
Abbas Raza, et al.,
bioRxiv - Genetics 2021
Quote:
... mice were injected with purified PTX (List Biological Laboratories, Inc.) in 0.025 M Tris buffer containing 0.5 M NaCl and 0.017% Triton X-100 ...
-
No products found
because this supplier's products are not listed.
Chengcheng Fan, Jens T. Kaiser, Douglas C. Rees,
bioRxiv - Biochemistry 2019
Quote:
NaAtm1 purified in DDM was crystallized in MemChannel (Molecular Dimensions) condition #29 ...
-
No products found
because this supplier's products are not listed.
Sana Charaoui-Boukerzaza, et al.,
bioRxiv - Microbiology 2019
Quote:
... The count of viable bacteria was carried out by plating serial dilutions of the lysates on blood agar (43041, bioMérieux) using an automatic seeder (EasySpiral Dilute, Interscience). The calculation of the bacterial loads was performed after incubation at 37°C for 24 h ...
-
No products found
because this supplier's products are not listed.
Heather Felgate, et al.,
bioRxiv - Genomics 2022
Quote:
... For Illumina sequencing DNA was extracted from the lysate with the Quick-DNA Fungal/Bacterial 96 kit (Cambridge Bioscience), in accordance with the manufacturer’s guidelines ...
-
No products found
because this supplier's products are not listed.
Mark S. Lee, et al.,
bioRxiv - Immunology 2021
Quote:
Product were purified using SpinSmart Nucleic Acid Purification Columns (Thomas Scientific) and sent to Eton Bioscience for sequencing with the following 5’ CD4 primer ...
-
No products found
because this supplier's products are not listed.
Wanying Liao, et al.,
bioRxiv - Zoology 2021
Quote:
... PCR products were purified with the EUROGOLD Cycle-Pure Kit (EuroClone, Milan, Italy) and subsequently sent for direct Sanger sequencing to an external sequencing company (GATC Biotech AG ...
-
No products found
because this supplier's products are not listed.
Alfa Herrera, et al.,
bioRxiv - Microbiology 2019
Quote:
... anti-MCF (produced with purified MCF protein by Lampire Biological Laboratories, Pipersville PA), anti-ARF1 (Novus Biologicals NBP1-97935) ...
-
Cat# HY-P0285-1 mg,
1 mg, USD $180.0
Ask
Gokulnath Mahalingam, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
The protein lysates were prepared from HEK-293T and 293T-hACE2 cells using RIPA buffer (Thermos scientific, VH310061) with protease inhibitor (MedchemExpress, HY-K0010) and estimated protein concentration of each sample by the Bradford assay ...
-
No products found
because this supplier's products are not listed.
Masaru Ito, et al.,
bioRxiv - Genetics 2023
Quote:
... Two Guinea pigs were immunized with purified RNF212B protein by Antibodies Incorporated (Davis, CA). The IgG fraction was purified from the resultant sera ...
-
No products found
because this supplier's products are not listed.
Laura von Schledorn, et al.,
bioRxiv - Bioengineering 2023
Quote:
... purified lung progenitor cells were resuspended in small airway epithelial cell growth medium (SAECGM; PromoCell) supplemented with 1% penicillin/streptomycin (Gibco) ...
-
No products found
because this supplier's products are not listed.
Matthew C. Cummins, et al.,
bioRxiv - Biophysics 2022
Quote:
Purified SEWN0.1 was concentrated to 225 μM and dispensed in 24-well crystallography trays (Hampton Research). The sample crystallized in hanging drops via vapor diffusion in 100 mM diammonium hydrogen citrate and 15% polyethylene glycol after approximately 3 days ...
-
No products found
because this supplier's products are not listed.
Clara Lambert, et al.,
bioRxiv - Microbiology 2023
Quote:
... and identified by comparing to retention times of purified esterified FA standards (Mixture ME100, Larodan, Sweden). Results are shown as percent of the specific FA compared to total peak areas (TotalChrom Workstation ...
-
No products found
because this supplier's products are not listed.
L. Mordechay, et al.,
bioRxiv - Immunology 2020
Quote:
... Purified NK cells were then cultured in stem cell serum-free growth medium (CellGenix GMP SCGM, 20802-0500) supplemented with 10% heat-inactivated human AB plasma from healthy donors (SIGMA ...