-
No products found
because this supplier's products are not listed.
Tasneem Qaqorh, et al.,
bioRxiv - Cell Biology 2023
Quote:
... diluted with 0.001% Poloxamer 188 (Sigma) in PBS targeting mouse Atf3 (pAAV[2miR30]-cTnT>sfGFP:{GAGCCTGGTGTTGTGCTATTTA}:{GAGATTCGCCATCCAGAATAAA} ...
-
No products found
because this supplier's products are not listed.
Sophie Robinson, et al.,
bioRxiv - Neuroscience 2024
Quote:
... A diafiltration step was then performed to concentrate the purified AAVs and reformulate them into PBS + 0.005% poloxamer 188 (# 13-901-CI, Corning) using Amicon Ultra-4 filter units (# UFC8100 ...
-
No products found
because this supplier's products are not listed.
Henning Peter Düsedau, et al.,
bioRxiv - Immunology 2021
Quote:
... MAP2 (2 µg/µl, #188 011, Synaptic Systems), and NeuN (dilution 1:2000 ...
-
No products found
because this supplier's products are not listed.
Shayna Thomas-Jardin, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... (Fisher Scientific, 50-188-2396)) beginning on Day 7 and continuing for the duration of the experiment ...
-
No products found
because this supplier's products are not listed.
Mayur Bajaj, Annapurna Devi Allu, Basuthkar J Rao,
bioRxiv - Plant Biology 2023
Quote:
... 200-300µl of 1x RIPA lysis buffer (Merck; 20-188) containing 10% glycerol ...
-
No products found
because this supplier's products are not listed.
Noelle V. Antao, et al.,
bioRxiv - Cell Biology 2023
Quote:
Fetal Bovine Serum (VWR 89510-188)
-
No products found
because this supplier's products are not listed.
Mohammed Samer Shaban, et al.,
bioRxiv - Immunology 2020
Quote:
... anti ATF3 (Santa Cruz, #sc-188), anti HERPUD1 antibody (Abnova ...
-
No products found
because this supplier's products are not listed.
Trever T. Greene, et al.,
bioRxiv - Immunology 2024
Quote:
... anti-human CD56 (MEM-188, BioLegend), HLA-DR (L243 ...
-
No products found
because this supplier's products are not listed.
Nicolas Castaño, et al.,
bioRxiv - Immunology 2022
Quote:
... We coated the DLD channels with Pluronic F68 (3% w/v, Alfa Aesar J66087 Poloxamer 188) to reduce the incidence of cell adhesion and the likelihood of clogging (74) ...
-
No products found
because this supplier's products are not listed.
Yasuko Tobari, et al.,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... and 188 mg/mL 5-bromo-4-chloro-3-indolyl phosphate (Roche Diagnostics) in a solution of 0.1 M Tris (pH 9.5) ...
-
No products found
because this supplier's products are not listed.
Jun Liu, et al.,
bioRxiv - Microbiology 2020
Quote:
... 3,3’-iaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions), was applied for 8 min ...
-
No products found
because this supplier's products are not listed.
Xiaoxiao Jin, et al.,
bioRxiv - Immunology 2021
Quote:
... AEC solution (BD) was used as the color developing agent and the developed spots were imaged and enumerated with professional plate reader.
-
No products found
because this supplier's products are not listed.
Adrian C. Johnston, et al.,
bioRxiv - Immunology 2024
Quote:
... BrightGlo solution (Promega) was then added to the wells and luminescence was read on a SpectraMax plate reader (Molecular Devices ...
-
No products found
because this supplier's products are not listed.
Boyi Zhang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... DAB solution (Vector Laboratories) was then added and the slides were counterstained with haematoxylin.
-
No products found
because this supplier's products are not listed.
Frederik Nørby Friis Sørensen, et al.,
bioRxiv - Neuroscience 2024
Quote:
... IgG1 κ Isotype (1:188, STEMCELL Technologies, 60070AD.1, 0.2 ug/µL) was used ...
-
No products found
because this supplier's products are not listed.
Guiping Wang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... murine RNAase inhibitor and 1 mg/ml yeast tRNA) and incubated with primary antibodies (Synaptic systems, 188 011, 314 006, 135 304, 106003, 131 005; Abcam, ab5392) in blocking buffer for 1 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Laura Alonso-Herranz, et al.,
bioRxiv - Immunology 2020
Quote:
... solution DMEM (Lonza) solution ...
-
No products found
because this supplier's products are not listed.
Mostafa Bakhti, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... The tissues were merged in 10% and 30% sucrose-PBS solutions at RT (2 h each solution) followed by 1:1 solution 30% sucrose:tissue-freezing medium (Leica 14020108926). Afterwards ...
-
No products found
because this supplier's products are not listed.
Jiageng Liu, et al.,
bioRxiv - Bioengineering 2024
Quote:
... 187.5 µL acrylamide solution (40% w/v Acrylamide Solution, 1610140, Bio-Rad), 100 µl 10x DPBS (14200075 ...
-
No products found
because this supplier's products are not listed.
Giuliana Giannuzzi, et al.,
bioRxiv - Genetics 2021
Quote:
... Protein Precipitation Solution (Qiagen) was added at 0.33x and mixed well ...
-
No products found
because this supplier's products are not listed.
Yue Li, et al.,
bioRxiv - Genomics 2021
Quote:
... Reduced osmium solution (EMS) was used to enhance the contrast in STEM HAADF mode ...
-
No products found
because this supplier's products are not listed.
Deepthi Ashok, et al.,
bioRxiv - Pathology 2024
Quote:
... Cardiomyocytes were purified using a PSC-Derived Cardiomyocyte Isolation Kit (130-110-188, Miltenyi Biotec). LS columns were used to enrich cardiomyocytes (130-042-401 ...
-
Sterile calcium and magnesium free Hank's balanced salt solution (CMFHBSS), pH 7.4, as supplied...
Cat# LK003210,
1 ea, $65.00
Ask
Xiaofei Li, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Papain solution (Worthington Biochemical ...
-
No products found
because this supplier's products are not listed.
Haoneng Tang, et al.,
bioRxiv - Cell Biology 2022
Quote:
... ELISA Stop Solution (Solarbio) was added and then absorbance at 450 nm was detected by Infinite M200 PRO Multimode Microplate Reader (TECAN) ...
-
No products found
because this supplier's products are not listed.
Michele Martins, et al.,
bioRxiv - Biochemistry 2020
Quote:
... iodoacetamide solution (GE Healthcare) was added ...
-
No products found
because this supplier's products are not listed.
Yue Qu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... adding CopyControl solution (EpiCentre) 2 hrs before the miniprep ...
-
No products found
because this supplier's products are not listed.
Samantha Sze, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and one in-solution (NEB) DNase digestions were performed ...
-
No products found
because this supplier's products are not listed.
Sylvan C. Baca, et al.,
bioRxiv - Cancer Biology 2020
Quote:
For WCM154 Western blots, cell pellets were lysed in RIPA buffer (MilliporeSigma, 20-188) supplemented with Protease/Phosphatase Inhibitor Cocktail (Cell Signaling Technology, 5872S). Protein concentrations were assayed with a Pierce BCA Protein Assay Kit (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Alexandra Lucas, et al.,
bioRxiv - Neuroscience 2021
Quote:
... solution (Liberate Antibody Binding Solution, Polysciences, Inc ...
-
No products found
because this supplier's products are not listed.
Xuandi Hou, et al.,
bioRxiv - Neuroscience 2020
Quote:
... RR solution (20 μM RR in Ca2+ solution, Tocris Bioscience) into the culture medium to evaluate the effect of mechanosensitive ion channels on US+GVs-elicited Ca2+ response ...
-
No products found
because this supplier's products are not listed.
Hiroki Sugishita, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 5 µl/well of beads were washed twice with TE solution and then resuspended in lambda DNA solution (diluted to approximately 20 ng/µL in TE solution, 3010, Takara). Then ...
-
No products found
because this supplier's products are not listed.
Samuel E. Lacey, Helen E. Foster, Gaia Pigino,
bioRxiv - Molecular Biology 2022
Quote:
... followed by 1uL 10nm colloidal gold fiducial solution (in PBS, BBI Solutions). Following 30s incubation at 22°C at 95% humidity ...
-
No products found
because this supplier's products are not listed.
Nozomi Hori, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Rediject Solution (Perkin Elmer). At 25 min later ...
-
No products found
because this supplier's products are not listed.
Federico Miozzo, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 1 × Denhardt’s solution (Eppendorf, 0032007.155). Hybridization was performed with a double DIG-labeled locked nucleic acid (LNA ...
-
No products found
because this supplier's products are not listed.
Udochukwu C. Obodo, Timothy R. O’Connor,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
MTT solution (Biotium, Hayward, CA) was diluted 1/10 in serum-free antibiotic-supplemented DMEM ...
-
No products found
because this supplier's products are not listed.
Thomas A. Johnson, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... (Olympus Scientific Solutions, Waltham, MA, USA), an Evolve 512 EM-CCD camera (Photometrics ...
-
No products found
because this supplier's products are not listed.
Yufei Xiang, et al.,
bioRxiv - Bioengineering 2020
Quote:
... After the STOP solution (R&D system), the plates were read at multiple wavelengths (the optical density at 550 nm wavelength subtracted from the density at 450 nm ...
-
No products found
because this supplier's products are not listed.
Dhananjay M. Nawandar, et al.,
bioRxiv - Microbiology 2022
Quote:
CsCl linear gradients were prepared by overlaying 8.5 mL of 1.46 g/cm3 CsCl solution with 8.5 mL of 1.2 g/cm3 CsCl solution in 17 mL Ultra-Clear tubes (Beckman Coulter), which were then spun at a 45-degree angle and a speed of 20 rpm for 13.5 minutes using Gradient Master (BioComp).
-
No products found
because this supplier's products are not listed.
Steffen Preissler, et al.,
bioRxiv - Biochemistry 2020
Quote:
... cells were washed twice in 1 ml TBS solution and suspended in TBS solution containing Alexa Fluor 488 Goat anti-mouse IgG (Jackson ImmunoResearch, 115-545-146 ...
-
No products found
because this supplier's products are not listed.
Kati J. Ernst, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... in a 50 ml tube (Corning 352070) (when having a frozen cell pellet as starting material, 3 ml of washing buffer and 15 ml tubes [Greiner Bio-One 188-271] were used). The debris and leaking RNA were removed by centrifugation (500 g ...
-
No products found
because this supplier's products are not listed.
Evgeny G. Chulkov, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Pipette solution: (3M KCl). (B ...
-
No products found
because this supplier's products are not listed.
Antonio Garcia-Guerra, et al.,
bioRxiv - Bioengineering 2024
Quote:
... in blocking solution (LI-COR) with 0.1% Tween 20 overnight at 4 °C ...
-
No products found
because this supplier's products are not listed.
Marion Lebouvier, et al.,
bioRxiv - Evolutionary Biology 2022
Quote:
Stock solution of alkyne-modified oleic acid (17-yne) (Avanti Polar Lipids, ethanol solution 1mg/ml) was aliquoted ...
-
No products found
because this supplier's products are not listed.
Simone Caielli, et al.,
bioRxiv - Immunology 2023
Quote:
... with 1x Cumate solution (System Biosciences) to induce protein expression ...
-
No products found
because this supplier's products are not listed.
Joshua M. Hazan, et al.,
bioRxiv - Genetics 2023
Quote:
... and 1% penicillin-streptomycin solution (Sartorius, Goettingen, Germany) and passaged every 2–4 days ...
-
No products found
because this supplier's products are not listed.
Piotr Michaluk, Janosch Heller, Dmitri A. Rusakov,
bioRxiv - Neuroscience 2020
Quote:
... supplemented with 25% Hank’s Balanced Salt Solution (MP Biomedicals), 25% horse serum ...
-
No products found
because this supplier's products are not listed.
Yurika Ito, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... The supernatant was incubated with a freshly prepared Working solution containing substrate and enzyme solution and then subjected to bioluminescent detection using a microplate reader (Infinite 200 PRO, TECAN). The ATP level was measured as a control with 1µmol/l of ATP stock solution ...
-
No products found
because this supplier's products are not listed.
S.A. Kitchen, et al.,
bioRxiv - Genetics 2020
Quote:
... 1 µl of OB Protease Solution (Omega BioTek) and 0.2 µl of RNAse A (100 mg/ml) ...
-
No products found
because this supplier's products are not listed.
Hanjin Liu, et al.,
bioRxiv - Biophysics 2024
Quote:
... to produce a fiducial marker along with 0.01% NP-40 and 10 μM tubulin solution with BRB80 buffer and 1 mM GTP before the solution was dropped onto the grids (QUANTIFOIL R 1.2/1.3 Cu 200). The grids were blotted with vitrobot (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Nolan R. McGrady, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 1.8M NaCl solution was then injected via glass micropipette (TIP01TW1F, WPI) at a flow rate of 309μL/min for 10 seconds in one eye while the fellow eye served as the contralateral control ...