Labshake search
Citations for Millipore Sigma :
1 - 50 of 10000+ citations for Poloxamer 188 solution since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... diluted with 0.001% Poloxamer 188 (Sigma) in PBS targeting mouse Atf3 (pAAV[2miR30]-cTnT>sfGFP:{GAGCCTGGTGTTGTGCTATTTA}:{GAGATTCGCCATCCAGAATAAA} ...
-
bioRxiv - Cancer Biology 2024Quote: ... was procured from Cayman chemical company and Poloxamer 188 was acquired from Sigma Aldrich. Acetonitrile was purchased from Fisher Scientific ...
-
bioRxiv - Genomics 2022Quote: ... Pellets were pooled and transferred to smaller tubes with 1x PBS + 200 mM NaCl + 0.001% Pluronic F68 (Poloxamer 188 Solution, cat. #P5556-100ML, Sigma) and pelleted again ...
-
bioRxiv - Cell Biology 2020Quote: 3D skeletal muscle tissues were incubated for 1 hour in poloxamer 188 (P188; Sigma, P5556) at 37 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... AAV2/5 vectors were thawed on ice and diluted to desired titers (2.5×109 GC/μl per vector for AAV-IFT140 and 1.5×109 GC/μl per vector for AAV-CDH23) in PBS supplemented with 0.001% Poloxamer 188 (Sigma Aldrich).
-
bioRxiv - Neuroscience 2021Quote: Poloxamer 407 (Sigma Aldrich), poloxamer 188 (Applichem) ...
-
bioRxiv - Neuroscience 2021Quote: ... poloxamer surfactant (Sigma P5556) was also added to S-Basal while loading the worms ...
-
bioRxiv - Physiology 2024Quote: ... poloxamer 407 (Sigma, catalog #16758). Blood was collected immediately prior to and up to 4 hours after receiving poloxamer 407 to measure plasma levels of triglyceride ...
-
bioRxiv - Physiology 2022Quote: ... poloxamer-407 (P-407; Sigma, P2443) was dissolved in ice-cold saline (250 mg/kg ...
-
bioRxiv - Neuroscience 2024Quote: ... Poloxamer 407 (Sigma-Aldrich, cat. #16758), recombinant control peptide (R&D systems ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 μl of poloxamer surfactant (Sigma P5556) was added to the S-Basal loading buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... mice were injected intraperitoneally with Poloxamer-407 (Sigma) solution in PBS (1 g per kg body weight ...
-
bioRxiv - Cancer Biology 2021Quote: ... 50μl of Kolliphor®P 188 (15 mM stock solution Sigma Cat# K4894), 37.5μl of 1M CaCl2 and 5μl of DNAse-1 (Sigma Cat# DN25 1000X stock 10mg/ml)] ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Each contained 2.5ml of the 0.02 mg/ml 10nm AgNP stock solution mixed with 5.0ml 30% poloxamer 407 (Pluronic® F-127, Sigma Aldrich) (1:2 ratio with a total Ag content of 0.05mg/specimen) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10X (20-188, Millipore, DARMstadt, Germany) containing phosphatase inhibitor cocktail tablets (04906837001 ...
-
bioRxiv - Physiology 2020Quote: ... Injection with 1 g/kg of body weight poloxamer 407 (Sigma-Aldrich) in PBS ...
-
bioRxiv - Biophysics 2021Quote: ... The Outer Aqueous (OA) solution additionally contained 50 mg mL−1 of Kolliphor P-188 (Sigma-Aldrich, UK) as per standard OLA protocols.38 Lipids were purchased from Sigma Aldrich in powder form and were dissolved in 100% ethanol to a final concentration of 100 mg mL−1 ...
-
bioRxiv - Bioengineering 2022Quote: ... and 2% Pluronix F68 (Kluplour 188, Sigma) in PBS ...
-
bioRxiv - Molecular Biology 2020Quote: ... 188 g Glycine (Sigma-Aldrich, G7126-500G), 10 g SDS (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2020Quote: ... and 2% Pluronix F68 (Kolliphor 188, Sigma) in PBS as described previously48 ...
-
bioRxiv - Bioengineering 2022Quote: ... and 2% Pluronic F68 (Kolliphor 188, Sigma) in 1×PBS ...
-
bioRxiv - Neuroscience 2024Quote: ... the outlet port was loaded with 5% v/v poloxamer surfactant (Sigma P5556) with 2% xylene cyanol (2 mg/ml ...
-
bioRxiv - Neuroscience 2023Quote: ... in RIPA lysis buffer (Millipore 20-188; 1×) 1% SDS solution after adding protease inhibitor (Roche 4693116001 ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were lysed with RIPA buffer (Millipore, 20-188) supplemented with protease inhibitor (cOmplete ...
-
bioRxiv - Microbiology 2020Quote: ... cells were lysed in RIPA Buffer (Millipore, 20-188) with protease inhibitors (cOmplete ...
-
bioRxiv - Cancer Biology 2024Quote: Cells were lysed in RIPA buffer (Millipore #20-188) supplemented with protease inhibitor (Sigma-Aldrich #11836153001 ...
-
bioRxiv - Cell Biology 2021Quote: ... we made 200 μl of gelation solution by mixing 188 μl of monomer stock solution (1 × PBS, 2 M NaCl, 8.625% (w/w) sodium acrylate (SA)(Sigma Aldrich 408220), 2.5% (w/w ...
-
bioRxiv - Cell Biology 2020Quote: Proteins were extracted using RIPA buffer (Sigma-Aldrich, 20-188) supplemented with Complete Mini EDTA-free Protease inhibitor cocktail (Roche ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were lysed in RIPA buffer (Sigma-Aldrich, 20-188) supplemented with Complete Mini EDTA-free Protease inhibitor cocktail (Roche ...
-
bioRxiv - Cancer Biology 2021Quote: Cell lysates were prepared using RIPA buffer (#20-188, Millipore) supplemented with protease and phosphatase inhibitors (#A32959 ...
-
bioRxiv - Biochemistry 2024Quote: ... The cells were lysed with RIPA buffer (Millipore; 20-188) containing protease inhibitor cocktail (Roche ...
-
bioRxiv - Microbiology 2023Quote: LS174T (ATCC CL-188) and HT29-MTX-E12 (Sigma #12040401) were grown in Dulbecco’s modified Eagle’s medium (DMEM ...
-
bioRxiv - Neuroscience 2024Quote: ... cell lysates extracted with 1x RIPA buffer (Millipore, 20-188) containing the protease inhibitor cocktail (Roche ...
-
bioRxiv - Cancer Biology 2024Quote: ... and phosphatase inhibitor cocktail II (Millipore-Sigma, Cat#20-188). Cells were kept chilled and scraped from the dish using a cell scraper ...
-
bioRxiv - Cancer Biology 2024Quote: ... and phosphatase inhibitor cocktail II (Millipore-Sigma, Cat#20-188). Cells were kept chilled and scraped from the dish using a cell scraper ...
-
bioRxiv - Cell Biology 2024Quote: Mitochondrial samples were resuspended in RIPA buffer (Millipore #20-188) containing protease inhibitors (Sigma #P8340) ...
-
bioRxiv - Microbiology 2021Quote: ... Cell pellets were lysed in RIPA buffer (Cat. #20-188, Millipore) containing protease inhibitor cocktail (Cat ...
-
bioRxiv - Cell Biology 2022Quote: Cell lysates were prepared with RIPA lysis buffer (20-188, Millipore) and quantitated for the amount of protein using a Bio-Rad Protein Assay Kit (5000002 ...
-
bioRxiv - Cancer Biology 2024Quote: Cells were lysed in radioimmunoprecipitation assay (RIPA) buffer (Millipore, #20-188). Lysates were incubated in Laemmli buffer (Bio-rad ...
-
bioRxiv - Physiology 2023Quote: ... cells were lysed in 1x RIPA buffer (EMD Millipore #20-188) supplemented with 1x SIGMAFAST protease inhibitor cocktail and 1X Phosstop phosphatase inhibitor (Roche #04906837001) ...
-
bioRxiv - Developmental Biology 2023Quote: ... protein lysates were prepared in 1× RIPA buffer (Millipore, #20-188) from Drosophila head tissue expressing UAS-FLAG-Dx ...
-
bioRxiv - Bioengineering 2023Quote: ... protein was extracted by using RIPA lysis buffer (20-188, Millipore) supplemented with cOmplete Mini protease and phosphatase inhibitors tablets (Roche) ...
-
bioRxiv - Genetics 2024Quote: Cells were lysed using RIPA lysis buffer (20-188, Millipore-Sigma) and incubated 30 min at 4°C before centrifugation at 13,000 rpm at 4°C ...
-
bioRxiv - Genetics 2024Quote: Cells were lysed using RIPA lysis buffer (20-188, Millipore-Sigma) and incubated 30 min at 4°C before centrifugation at 13,000 rpm at 4°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... with 500 µL of 2X RIPA buffer (Millipore Sigma, 20-188) supplemented with 1X protease inhibitor cocktail (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... forebrain homogenates were treated with 10x RIPA lysis buffer (Millipore, 20-188) and 1x Halt TM Protease & Phosphatase (PP ...
-
bioRxiv - Immunology 2020Quote: ... Cells were collected and resuspended in RIPA buffer (Millipore, Cat# 20-188) with protease inhibitors (Roche ...
-
bioRxiv - Molecular Biology 2023Quote: ... Tissues and cells were homogenized in RIPA lysis buffer (Millipore, #20-188) containing protease and phosphatase inhibitors (Complete Mini ...
-
bioRxiv - Immunology 2023Quote: ... Soluble lipid stores were created in Kolliphor P 188 (Millipore Sigma K4894) according to lipid supplement instructions.
-
bioRxiv - Microbiology 2024Quote: ... were lysed using 50μl of RadioImmunoPrecipitation Assay (RIPA) buffer (Millipore # 20-188) supplemented with protease and phosphatase inhibitors (Selleck # B15001 & B14001) ...