-
No products found
because this supplier's products are not listed.
Maya Gershkovitz, et al.,
bioRxiv - Immunology 2020
Quote:
... α-mouse PD-L1-PE (BioLegend), α-mouse PD1-APC (BioLegend) ...
-
No products found
because this supplier's products are not listed.
Wonkyung Oh, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... mouse PD-L1 (10F.9G2 clone [BioXcell, Lebanon ...
-
No products found
because this supplier's products are not listed.
Ruud H. Wijdeven, et al.,
bioRxiv - Immunology 2021
Quote:
... Western blot: mouse anti-PD-L1 (Cell Signaling, #29122), mouse anti-Actin (Sigma ...
-
No products found
because this supplier's products are not listed.
Meher Patel, et al.,
bioRxiv - Immunology 2022
Quote:
... PD-L1 (BD Pharmingen) and TLR4 (eBioscience) ...
-
No products found
because this supplier's products are not listed.
Julius Benicky, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... with C-terminal 6xHis tag produced in HEK293 cells and human recombinant PD-L1-Fc chimera protein produced in mouse NS0 cells were obtained from R&D Systems, Minneapolis ...
-
No products found
because this supplier's products are not listed.
Qing Peng, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... mouse anti-PD-L1 antibody (abcam, ab238697), rabbit anti-GAPDH antibody (Abways ...
-
No products found
because this supplier's products are not listed.
Georgi Apriamashvili, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... anti-mouse PD-L1 (MIH5, Thermo Fisher Scientific, 14-5982-81).
-
No products found
because this supplier's products are not listed.
Ian Tietjen, et al.,
bioRxiv - Microbiology 2021
Quote:
... 0.5 nM of human PD-L1-Fc (Sino Biological) was incubated with 5 nM HIS-tagged human PD-1 (Sino Biological ...
-
No products found
because this supplier's products are not listed.
Farooq Syed, et al.,
bioRxiv - Physiology 2024
Quote:
... mouse anti-PD-L1 (Proteintech), and rabbit anti-CXCL10 (Invitrogen) ...
-
No products found
because this supplier's products are not listed.
Lindsay B Alcaraz, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... PD-L1 (rabbit monoclonal, clone SP142, Roche) and CD163 (mouse monoclonal ...
-
No products found
because this supplier's products are not listed.
Alexander G. Raufi, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... PD-L1 (clone 22C3; Dako; 1:150). Briefly ...
-
No products found
because this supplier's products are not listed.
Michał Mikitiuk, et al.,
bioRxiv - Molecular Biology 2023
Quote:
The PD-1/PD-L1 immune checkpoint bioassay (PD-1/PD-L1 Bioassay, Promega) was performed according to the manufacturer’s manual ...
-
No products found
because this supplier's products are not listed.
Rui Sun, Hyeyoon Lee, Christof Niehrs,
bioRxiv - Bioengineering 2022
Quote:
... Human PD-L1-GFP (pEGFP-N1/PD-L1) was a gift from Mien-Chie Hung (Addgene plasmid # 121478 ...
-
No products found
because this supplier's products are not listed.
Bogdan Musielak, et al.,
bioRxiv - Biophysics 2020
Quote:
... while recombinant PD-L1 (18 – 134 aa) and PD-L1-Long (19 – 238 aa) were cloned into pET-21b and pET-28a (Novagen), respectively ...
-
No products found
because this supplier's products are not listed.
Kayla Myers Chen, et al.,
bioRxiv - Immunology 2024
Quote:
... APC mouse PD-L1 from Tonbo Biosciences. In addition ...
-
No products found
because this supplier's products are not listed.
Christian Hentrich, et al.,
bioRxiv - Biochemistry 2023
Quote:
Jurkat-Lucia TCR-hPD-1 effector cells and Raji-APC-hPD-L1 antigen presenting cells were obtained from Invivogen as components of the PD-1/PD-L1 Bio-IC assay (Invivogen, #rajkt-hpd1). The cells were cultivated in IMDM with glutamine and HEPES (Gibco ...
-
No products found
because this supplier's products are not listed.
Wonkyung Oh, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... was coated with hPD-L1-His protein and anti-PD-L1 antibody and anti-mouse IgG specific HRP conjugated secondary antibodies (SouthernBiotech, Birmingham, AL, USA) were added ...
-
No products found
because this supplier's products are not listed.
Xiaopei Cui, et al.,
bioRxiv - Immunology 2023
Quote:
sgRNAs (PD-L1: 5’TCTTTATATTCATGACCTAC; CD155: 5’CCCGAGCCATGGCCGCCGCG) were chemically synthesized (GenScript). Ribonucleoproteins (RNPs ...
-
No products found
because this supplier's products are not listed.
Yvette Robbins, et al.,
bioRxiv - Immunology 2020
Quote:
PD-L1 CAR haNK cells were assessed for PD-L1 CAR expression via staining with biotinylated recombinant human PD-L1 (ACROBiosystems) followed by staining with a fluorophore conjugated to streptavidin ...
-
No products found
because this supplier's products are not listed.
Scott E. James, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... CD22-deleted clones modified to express PD-L1 (LZRS PD-L1) or CD200 (PB-EF-1α-intron CD200, pCMV-hyPBase, SF buffer kit V4XC-2032, Lonza 4D Nucleofector, code DN100). Transposition reactions used 1-2 μg of vector DNA and 0.5-1.0 μg of pCMV-hyPBase transposase DNA ...
-
No products found
because this supplier's products are not listed.
Siya Zhang, et al.,
bioRxiv - Biophysics 2021
Quote:
... mouse anti-human PD-L1 (primary antibody, CD273, Clone OTI9E12, ORIGENE, MD, USA) and APC goat anti-mouse IgG (secondary antibody ...
-
No products found
because this supplier's products are not listed.
Nivedha Murali Shankar, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Cells were stained with antibodies specific for PD-L1 (Miltenyi Biotec) and ErbB2 (R&D Systems ...
-
No products found
because this supplier's products are not listed.
N Kislev, et al.,
bioRxiv - Cell Biology 2021
Quote:
Mouse embryonic 3T3-L1 preadipocytes (American Type Culture Collection) were cultured and differentiated as was previously described41 ...
-
No products found
because this supplier's products are not listed.
Wenqiang Shi, et al.,
bioRxiv - Immunology 2022
Quote:
... anti-PD-L1 and LH02 were all purified by affinity chromatography using a protein A affinity column (GE Healthcare, Piscataway, NJ, USA) and analyzed in reducing condition on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).
-
No products found
because this supplier's products are not listed.
Annette B. Vogel, et al.,
bioRxiv - Immunology 2020
Quote:
... Anti-mouse-Fc-antibody (Jackson ImmunoResearch) was diluted in 10 mM sodium acetate buffer pH 5 (30 µg/mL ...
-
No products found
because this supplier's products are not listed.
Wonkyung Oh, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... we transfected mouse PD-L1 double nickase plasmid (Santa Cruz Biotechnology, Dallas, TX, USA) into E0771 cells using X-tremeGENE transfection reagent ...
-
No products found
because this supplier's products are not listed.
Roberto Cuttano, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 7.5nM of PD-L1-specific miR-455-5p TSB (339194; sequence: GTAGACTATGTGCCTTTGCTCAG; Qiagen) or scramble TSB (339194 ...
-
No products found
because this supplier's products are not listed.
Yuhao Shi, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... pre-treatment and post-treatment/acquired resistant biopsies were obtained from patients receiving various immune checkpoint inhibitor treatments (PD-L1, PD-1, CTLA-4 targeted therapies) for RNA-seq analysis (Illumina HiSeq2500) from formalin fix paraffin embedded samples ...
-
No products found
because this supplier's products are not listed.
Susanta Chatterjee, et al.,
bioRxiv - Molecular Biology 2021
Quote:
TET-ON stable HEK293 cells with the Tetracycline-inducible expression constructs were grown in DMEM supplemented with 10% TET-approved FCS (Clontech) and induction of expression of respective gene product was carried out for indicated time durations using 400 ng/ml Doxycycline (SIGMA) ...
-
No products found
because this supplier's products are not listed.
Wenqiang Shi, et al.,
bioRxiv - Immunology 2022
Quote:
... PD-L1 (ABclonal, Wuhan, China) or TGF-β1 (Abcam) ...
-
No products found
because this supplier's products are not listed.
Martina Ruglioni, et al.,
bioRxiv - Biophysics 2023
Quote:
αPD-L1: Rabbit anti-PD-L1 monoclonal IgG (mAb D8T4X, #86744 Cell Signaling, Euroclone, Milan, Italy). Immunolabeling dilution ...
-
No products found
because this supplier's products are not listed.
Yukiko Yamaguchi, et al.,
bioRxiv - Immunology 2022
Quote:
... and goat anti-human PD-L1 (1:50, Leinco Technologies, B560) at 4°C overnight and washed in PBS+0.1% Tween 20 for 5 min three times ...
-
No products found
because this supplier's products are not listed.
Sonal Jaiswal, Srishti Sanghi, Priyanka Singh,
bioRxiv - Cell Biology 2023
Quote:
... and anti-mouse IgG (Fc) TRITC (Merck, #SAB3701020, 1:500).
-
No products found
because this supplier's products are not listed.
Christian L. Egly, et al.,
bioRxiv - Biochemistry 2024
Quote:
... All HEK293 cells were cultured in HEK293 media consisting of Minimum Essential Media (MEM, Corning) containing 10% (v/v ...
-
No products found
because this supplier's products are not listed.
Youichi Tajima, Futoshi Shibasaki, Hisao Masai,
bioRxiv - Cancer Biology 2022
Quote:
... anti-PD-L1 (GTX104763, GeneTex), anti-PD-1 (mouse specific)(#84651 ...
-
PD-1/PD-L1 Inhibitor 3(Programmed Death-1/Programmed Death-Ligand 1 Inhibitor 3)is a Macrocyclic...
Cat# S8158, SKU# S8158-1mg,
1mg, $197.00
Ask
Vasu R Sah, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Absence of PD-L1 expression in the PD-L1 knockout cells was confirmed in cells treated with entinostat (Selleck Chemicals, Houston, TX) to induce PD-L1.
-
No products found
because this supplier's products are not listed.
Wonkyung Oh, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... of PD-L1 protein/PD-L1 antibody was determined by Octet Biolayer interferometry (BLI) using the Octet RED384 system (Sartorius, Bohemia, NY, USA). Briefly ...
-
No products found
because this supplier's products are not listed.
Yvette Robbins, et al.,
bioRxiv - Immunology 2020
Quote:
... and PD-L1 (clone E1L3) internally validated on a fully automated platform (Leica Bond RX). Multispectral images were acquired using Polaris System (PerkinElmer/Akoya).
-
No products found
because this supplier's products are not listed.
Shuwei Xie, et al.,
bioRxiv - Cell Biology 2021
Quote:
... mouse monoclonal anti-MICAL-L1 antibodies (Novus Biologicals), mouse monoclonal anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH ...
-
No products found
because this supplier's products are not listed.
Xiang Gao, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The protein bands were probed with PD-L1 Ab and detected using LI-COR Odyssey system (LI-COR Biosciences, Lincoln, NS). Anti-mouse β- tubulin Ab (Abcam ...
-
No products found
because this supplier's products are not listed.
Shingo Hanaoka, Shinji Saijou, Yasuhiro Matsumura,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... reacted with HRP-conjugated anti-human IgG-Fc antibody or anti-mouse IgG-Fc antibody (Bethyl) for 1 hour ...
-
No products found
because this supplier's products are not listed.
Xiaotong Ji, et al.,
bioRxiv - Biophysics 2021
Quote:
... A biolistic PDS-1000He instrument (Bio-Rad, CA, USA) was used to bombard tobacco cells with this constructed plasmid ...
-
No products found
because this supplier's products are not listed.
Rui Zhang, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... PD-L1 (Bioss, bsm-54472R) and mouse anti-GAPDH (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Michael C. Kiritsy, et al.,
bioRxiv - Immunology 2020
Quote:
... and PD-L1 were performed as follows: 2e8 cells of the knockout (KO) library was stimulated with IFNγ (10ng/mL; Peprotech 315-05) for 24 hours after which cells were harvested by scraping to ensure integrity of cell surface proteins ...
-
No products found
because this supplier's products are not listed.
Hideaki Yano, Leanne Liu, Sett Naing, Lei Shi,
bioRxiv - Biochemistry 2019
Quote:
... PD 144418 (Tocris), and haloperidol (Tocris)] were added to each well in serial dilution ...
-
No products found
because this supplier's products are not listed.
Pengfei Wang, et al.,
bioRxiv - Microbiology 2021
Quote:
... and transfected into HEK293 cells using polyethyleneimine (Polysciences). Cell growths were harvested four days after transfection ...
-
No products found
because this supplier's products are not listed.
Martin P. Schwalm, et al.,
bioRxiv - Biochemistry 2023
Quote:
HEK293 cells were cultured in DMEM (PAN Biotech). All media were supplemented in with 10% FBS (PAN Biotech ...
-
No products found
because this supplier's products are not listed.
Berislav Bošnjak, et al.,
bioRxiv - Immunology 2022
Quote:
... FCS files were analyzed using FCS Express V7 (De Novo Software) or FlowJo V10 (BD).
-
No products found
because this supplier's products are not listed.
Catarina Nascimento, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... the exons of interest in PD-L1 gene were amplified by using specific primers (Table 5) with a PCR thermal cycler (VWR Thermocycler, Leicestershire, England). PCR procedures were performed with a standard reaction mixture (4 μl/sample of Phusion GC Buffer (Thermo Fischer Scientific) ...
-
No products found
because this supplier's products are not listed.
James P Bridges, et al.,
bioRxiv - Cell Biology 2021
Quote:
HEK293 cells were seeded in 384-well plates (Greiner, #781946) at 30 000 cells/well ...