Labshake search
Citations for Qiagen :
1 - 50 of 453 citations for PD L1 Mouse HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... 7.5nM of PD-L1-specific miR-455-5p TSB (339194; sequence: GTAGACTATGTGCCTTTGCTCAG; Qiagen) or scramble TSB (339194 ...
-
bioRxiv - Cancer Biology 2020Quote: Total RNAs were isolated from the A549 cells transfected with PD-L1-lnc overexpressed vector or control vector by TRIzol reagent and purified by RNeasy Mini Kit (Qiagen, USA). RNA samples were performed to Microarray analysis by Agilent SurePrint G3 human gene expression Microarray 8X60K (Agilent Technologies) ...
-
bioRxiv - Neuroscience 2023Quote: ... L1-L5 mouse DRG was homogenized with an RNeasy Mini Kit (Qiagen, Valencia, CA) using on-column DNase-I digestion according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2020Quote: Genomic DNA from mouse tissues and cultured HEK293 cells were extracted using DNeasy Blood & Tissue Kit (Qiagen, Germantown, MD). Total RNA was extracted from mouse tissues and HEK293 cells using Quick-RNA MiniPrep Kit (ZYMO Research ...
-
bioRxiv - Biochemistry 2022Quote: ... coli codon optimized L1 ORF0 sequence generated by Miniprep (Qiagen). 8nM EN WT and inhibitors or vehicle were incubated at room temperature for 1 hour before adding 2nM plasmid ...
-
bioRxiv - Immunology 2021Quote: ... DNA was extracted from circulating PD-1+ and PD-1− CD8+ T cells using the All-Prep DNA/RNA Micro Kit from Qiagen and sent to Adaptive Biotechnologies for survey-level TCRβ sequencing.
-
bioRxiv - Neuroscience 2021Quote: HEK293 cells and MEFs were transiently transfected with PolyFect (Qiagen) and Lipofectamine 3000 (Thermo Fisher ...
-
bioRxiv - Developmental Biology 2021Quote: ... Transfection of HEK293 cells was performed using Attractene transfection reagent (Qiagen) by the fast-forward transfection approach following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... or EGFP-Lin52 fusions into HEK293-GP cells with Effectene (Qiagen) for transduction as described previously (58).
-
bioRxiv - Cell Biology 2021Quote: ... HEK293 or U20S cells with the RNeasy Mini-kit (Qiagen, Hilden, Germany) and quantified with a NanoDrop 8000 spectrophotometer (Thermo-Fisher) ...
-
bioRxiv - Physiology 2020Quote: ... total RNA was isolated from differentiated 3T3-L1 cells using the RNeasy kit (Qiagen, Hilden, Germany). cDNA was generated using the High-Capacity cDNA Reverse Transcription kit (ThermoFisher Scientific ...
-
bioRxiv - Biochemistry 2021Quote: Messenger RNA was extracted from HEK293 cells using an RNeasy Mini kit (Qiagen) according to the manufacturer’s instructions and used as the template to synthesise complementary DNA (cDNA ...
-
bioRxiv - Biophysics 2024Quote: The HEK293 stable cell lines were generate by a transfection with Effectene (Qiagen) and 1µg plasmid (pmCherry-N1-hERG-WT and -A561V ...
-
bioRxiv - Immunology 2020Quote: Total RNA of IFN-α2 treated HEK293 cells was purified using RNeasy columns (Qiagen) with on-column DNase I digestion ...
-
bioRxiv - Genetics 2023Quote: ... Total RNA was extracted from D0 and D7 3T3-L1 cells using an RNeasy Plus Mini Kit (Qiagen #74134). RNA concentration was measured by NanoDrop (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... HEK293 cells were transfected with hTRPM3α2-GFP or its mutants using the Effectene reagent (Qiagen). Cells were loaded with 1 μM fura-2 AM (Invitrogen ...
-
bioRxiv - Genetics 2022Quote: ... 3-5 positive colonies per L1 element were chosen for Miniprep culture and plasmid DNA was isolated using QIAprep Spin Miniprep Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: Genomic DNA was isolated from 3T3-L1 preadipocytes (day 0) and differentiated adipocytes (day 5) using DNeasy Tissue kit (Qiagen). Two µg of each DNA sample was bisulfite modified using EpiTect Bisulfite kit (Qiagen) ...
-
bioRxiv - Plant Biology 2024Quote: Total RNA was extracted from 100 mg leaf samples of stressed and unstressed plants [three replicates of each control (WT) and transgenic (L1) plants] using the RNeasy Plant Mini kit (Qiagen, Germany). Sequentially first strand cDNA ...
-
bioRxiv - Cell Biology 2019Quote: ... by retrotranscription of RNAs from HeLa and HEK293-T cells using the QuantiTect Reverse Transcription kit (Qiagen) followed by PCR-mediated amplification and plasmid insertion with the in-Fusion cloning kit (Clontech) ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA was extracted from the parental and knockout HEK293 cells using QIAamp DNA mini kit (QIAGEN) and PCR amplified with primers located ~500-600 bp from the sgRNA target site ...
-
bioRxiv - Genetics 2023Quote: The extraction of total RNA from HEK293 stable cell lines was isolated by RNeasy mini kit (QIAGEN), and cDNA was reversed with Maxima First Strand cDNA Synthesis Kit (ThermoFisher Scientific) ...
-
bioRxiv - Genomics 2022Quote: ... At least 3 positive colonies per L1 were chosen for Miniprep culture and plasmid DNA was isolated using a QIAprep Spin Miniprep Kit (Qiagen, Cat#: 27106). At least three clones per element were capillary sequenced and compared to identify PCR-induced mutations ...
-
bioRxiv - Cell Biology 2021Quote: RNA was isolated from HEK293 cells using the QIAshredder and RNeasy Mini kit (Qiagen, 79654 and 74104, respectively). Briefly ...
-
bioRxiv - Cell Biology 2024Quote: HEK293 cells were seeded in 15 cm plates and transfected after 24h according to manufacturer protocols (Effectene, Qiagen) using 5 µg of plasmid DNA ...
-
bioRxiv - Physiology 2021Quote: RNA was isolated from the three HEK293 cell lines after 48 h in culture using the RNeasy Protect Mini Kit (catalog #74124, Qiagen). After reverse transcription (Super-Script II reverse transcriptase ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK293 cells were transfected with plasmids (WT mGlu1, the mGlu1 mutants, or the control vector) using SuperFect transfection reagent (Qiagen) or Viafect (promega ...
-
bioRxiv - Cell Biology 2021Quote: Total mRNA was isolated from HEK293 (2×106) and Jurkat cells (4×106) parental and MCU-KO cell lines using the RNeasy Mini Kit (Qiagen). Isolated RNA was then analyzed using a NanoDrop spectrophotometer (Thermo Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... Approximately 5×106 HEK293 cells were used to isolate RNA with the All Prep RNA/DNA Mini Kit (Qiagen; 80204). cDNA was generated using 1μg of RNA with oligo(dT ...
-
bioRxiv - Cell Biology 2024Quote: ... into 4 million HEK293-GP cells in 300 µl Buffer EC with 16 µl Enhancer and 60 µl Effectene Transfection Reagent (Qiagen 301425) (Morgenstern and Land ...
-
bioRxiv - Biophysics 2021Quote: ... and Fc-tag ACE2 protein was purified using a protein affinity A column (Qiagen). Proteins were further purified by gel filtration (Superdex™ 200 Increase 10/30GL ...
-
bioRxiv - Genetics 2022Quote: ... the PCR fragment and the plasmid fragment without PDS gene were isolated from agarose gel using QIAquick Gel Extraction Kit (Qiagen, catalog number 28706). The digested PCR products and the pBSMVγ plasmid were ligated using T4 ligase (New England BioLabs ...
-
bioRxiv - Immunology 2023Quote: ... supernatants were harvested and His-tagged tIgM-Fc (tFcµ) protein was purified using Ni-NTA Agarose (Qiagen) and subsequently ...
-
bioRxiv - Molecular Biology 2020Quote: ... selected by p value and/or fold change (FC) as indicated were uploaded into the IPA software (Qiagen). The Core Analyses function included in the software was used to interpret the data for top canonical pathways.
-
bioRxiv - Microbiology 2023Quote: ... All treatment groups were supplemented with 1 % FCS and RNA was extracted in RNAeasy Plus lysis buffer (QIAGEN) 6 h post treatment.
-
bioRxiv - Neuroscience 2022Quote: RNA from frozen FC area 8 was extracted following the supplier’s instructions (RNeasy Mini Kit, Qiagen® GmbH, Hilden, Germany). RNA integrity and 28S/18S ratios were determined with the Agilent Bioanalyzer (Agilent Technologies Inc ...
-
bioRxiv - Immunology 2021Quote: ... adherent cells were collected and either analyzed by FC or subjected to RNA isolation using the RNeasy Mini Kit (Qiagen #74106).
-
bioRxiv - Physiology 2022Quote: ... Mouse Obesity (PAMM- 017ZC-12) array and Mouse Aging (PAMM-178ZC) from Qiagen (Maryland, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Realtime-qPCR was performed on 11 differentially expressed (DE) miRNAs based on miRNA-seq results (|FC| ≥ 2, P < 0.05) using miScript SYBR Green PCR Kit (Qiagen 218073, California, USA) according to the manufacturer’s instructions with StepOne Applied Biosystems real-time PCR machine (Applied Biosystems ...
-
bioRxiv - Biochemistry 2023Quote: The coding sequence of mouse Donson was amplified from XpressRef Universal Total mouse RNA (QIAGEN, 338114) by RT-PCR (Takara ...
-
bioRxiv - Immunology 2019Quote: ... StrEP-Tag (mouse monoclonal, Qiagen, #34850). Peroxidase-conjugated secondary antibodies against rabbit IgG (#7074 ...
-
bioRxiv - Microbiology 2020Quote: ... mouse β-actin (PPM02945B-200, Qiagen), or MHV-A59 N gene using RT2 SYBR Green qPCR Mastermix (330502 ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse anti-His (Qiagen, number 34660); Mouse anti-β-actin (Proteintech ...
-
bioRxiv - Microbiology 2021Quote: ... mouse anti-Strep (Qiagen, Cat# 34850), and mouse anti-Histidine (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: The siRNA against mouse VCP (Qiagen, catalog # ...
-
bioRxiv - Biochemistry 2022Quote: ... A mouse monoclonal His-tetra (Qiagen) antibody (1:1000 dilution ...
-
bioRxiv - Immunology 2022Quote: ... Mouse and viral DNA were isolated from mouse tissue using the Qiagen DNeasy Blood and Tissue Kit (Qiagen). iTAQ universal Syber Green supermix (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-His tag (1:2000; QIAGEN) and rabbit anti-GST (1:2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-His from Qiagen (1:10,000), home-made rabbit anti-VASH1 ...
-
bioRxiv - Physiology 2019Quote: ... as well as mouse Tbp (Quantitect, Qiagen) as a housekeeping gene.