Labshake search
Citations for GenScript :
1 - 50 of 207 citations for PD L1 Mouse HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: sgRNAs (PD-L1: 5’TCTTTATATTCATGACCTAC; CD155: 5’CCCGAGCCATGGCCGCCGCG) were chemically synthesized (GenScript). Ribonucleoproteins (RNPs ...
-
bioRxiv - Cancer Biology 2020Quote: ... the PD-L1-lnc shRNA vectors were synthesized and then cloned into pLKO.1 vector (GenScript, China). The siRNA target sequences were listed in table S3 ...
-
bioRxiv - Cancer Biology 2020Quote: ... the full-length cDNA of PD-L1-lnc was synthesized and cloned into pcDNA3.1-P2A-eGFP vector (GenScript, China). To suppress PD-L1-lnc ...
-
bioRxiv - Immunology 2022Quote: ... using eBlot L1 (GenScript). Membranes were blocked and stained with primary antibody overnight in 5% nonfat dry milk in 0.1% PBST ...
-
bioRxiv - Molecular Biology 2022Quote: IgGFc: Human IgG Fc Sequence (Supplementary Material Figure S1) was codon optimized for HEK293 expression and synthesized from Genscript USA in pUC57 vector ...
-
bioRxiv - Neuroscience 2022Quote: ... Proteins were transferred to PVDF membranes with the eBlot® L1 system using eBlot® L1 Transfer Stack supports (Genscript) and the resulting membranes were washed three times with TBS-T (Tris-buffered saline containing 0.1 % Tween® 20 (Merk)) ...
-
bioRxiv - Cell Biology 2021Quote: ... Gels were transferred through eBlot L1 (GenScript L00686) onto nitrocellulose membranes (BioRad 1620112) ...
-
bioRxiv - Microbiology 2021Quote: ... eBlot L1 –Fast Wet Protein Transfer System (GenScript) was used for blotting and proteins were stained using the following antibodies ...
-
LRP1 mediates leptin transport by coupling with the short-form leptin receptor in the choroid plexusbioRxiv - Neuroscience 2023Quote: ... Neuro-2a cells or HEK293 cells were transiently transfected with pcDNA3.1(+)-C-DYK-mLRP1 (mouse LRP1 CDS; NM_008512.2, Genscript) and pcDNA3.1(+)-N-HA-mLepR (mouse LepR isoform A CDS ...
-
bioRxiv - Microbiology 2020Quote: ... Horseradish peroxidase (HRP) labeled-mouse anti-human IgG-Fc specific (GenScript No. A01854) diluted 1:10,000 in PBST was added (100μl/well ...
-
bioRxiv - Immunology 2021Quote: ... nonreducing gels and transferred using eBlot L1 Transfer system (GenScript). Blots were blocked in 5% Bovine Serum Albumin (BSA ...
-
bioRxiv - Cancer Biology 2024Quote: ... using the eBlot™ L1 Fast Wet Transfer System (GenScript) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... using an eBlot™ L1 wet transfer (GenScript Biotech, China). Membranes were blocked and incubated with primary antibodies and secondary antibodies using eZwest Lite Automated Western Device (GenScript Biotech ...
-
bioRxiv - Genomics 2021Quote: ... human Hek293 DNA was purchased from Genscript. S ...
-
bioRxiv - Zoology 2020Quote: ... Gels were stained with Coomassie brilliant blue using eStainTM L1 (Genscript).
-
bioRxiv - Cell Biology 2022Quote: ... Protein was transferred to a PVDF membrane using eBlot L1 (Genscript). Blocking was performed with 5% milk in PBST (PBS + 0.1% TritonX-100 ...
-
bioRxiv - Biochemistry 2023Quote: ... followed by staining using the eStain L1 Protein Staining System (GenScript). PAGE-MASTER Protein Standard Plus (GenScript ...
-
bioRxiv - Microbiology 2022Quote: ... recombinant human ACE2-IgG-Fc fragments (r-hACE2-Fc) (GenScript, Z03516) were firstly incubated with the Protein-G agarose (Millipore ...
-
bioRxiv - Plant Biology 2021Quote: ... using a highly efficient wet protein transfer system (eBlot L1; GenScript, Nanjing, China). The membranes were blocked for 2 h at room temperature in TBST solution (2 mM This-HCl ...
-
bioRxiv - Plant Biology 2023Quote: ... and transferred to PVDF membrane using an eBlot™ L1 transfer system (GenScript). The target proteins were probed with corresponding antibodies.
-
bioRxiv - Microbiology 2021Quote: ... ACE-2 –Fc (GenScript Z033484) was diluted at 1.2µg/ml in HBS P+ (Cytiva ...
-
bioRxiv - Immunology 2020Quote: Recombinant human ACE2-Fc (Genscript) at concentration of 2 μg/ml in phosphate buffer saline (PBS ...
-
bioRxiv - Plant Biology 2022Quote: ... Sample in the gel were transferred to PVDF membrane using eBlot™ L1 (GenScript Corporation). Anti-HA (1:5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... whereas all other gels were stained using the eStain™ L1 protein staining system (GenScript). Precision Plus Protein™ standards (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2020Quote: ... the recombinant protein ACE2-Fc (Genscript) at 5 μg/mL buffered in PBST (PBS with 0.02% Tween 20 ...
-
Sterilizing immunity against SARS-CoV-2 in hamsters conferred by a novel recombinant subunit vaccinebioRxiv - Microbiology 2020Quote: ... Coomassie brilliant blue staining for SDS-PAGE were performed using eStain L1 Protein Staining machine (Genscript). Gels for western blot were transferred onto the nitrocellulose membrane and reacted with COVID-19-convalescent serum (1:500 diluted) ...
-
bioRxiv - Genomics 2020Quote: Genomic DNA from the HEK293 cell line was purchased from GenScript (https://www.genscript.com).xs
-
bioRxiv - Biochemistry 2023Quote: ... or proteins were transferred to PVDF membranes using an eBlot L1 protein transfer system (GenScript, Piscataway, NJ) and used for immunoblotting.
-
bioRxiv - Immunology 2023Quote: ... was used as a capture antibody and rabbit polyclonal antibody raised against IL-7Rγ peptide agonist followed by a mouse anti-rabbit IgG Fc HRP (Genscript Cat# A01856-200) as a detection antibody ...
-
bioRxiv - Bioengineering 2021Quote: ... 843 RUs of SARS-CoV-2 RBD/SD1 fused to human Fc (RBD/SD1-Fc) and 972 RUs of EGFR (Genscript, Piscataway ...
-
bioRxiv - Immunology 2020Quote: ... hACE2-Fc was synthesized and cloned by GenScript with a BM40 signal peptide ...
-
bioRxiv - Microbiology 2021Quote: ... hACE2-Fc was synthesized and cloned by GenScript with a BM40 signal peptide ...
-
bioRxiv - Microbiology 2022Quote: ... Immunizations were done on eight-to twelve-week-old H2L2 mice interperitoneally with 50-100 μg of a recombinant SARS-CoV2 Spike RBD319-591-Fc fusion protein generated from sequence from the original Wuhan seafood market pneumonia virus isolate (GenBank Accession# MN908947) and cloned in-frame into pcDNA vectors containing human IgG1 and mouse IgG2a Fc tags (GenScript USA Inc., Piscataway, NJ). Each mouse received a prime followed by 2 boosts ...
-
bioRxiv - Microbiology 2020Quote: ... the recombinant protein of the extracellular domain of human ACE2 (aa 1-740) fused to Fc (ACE2-Fc, Genscript, Nanjing, China) was coated on 96-well microtiter plate (50 ng/well ...
-
bioRxiv - Cancer Biology 2023Quote: The inducible L1 reporter plasmid used to generate HeLa tet-L1/GLucAI cells (pBH001) was generated through a series of successive PCR-based cloning steps performed by GenScript. pBH001 is comprised of a tetracycline-regulated bidirectional promoter for inducible expression of both firefly luciferase (a fragment cloned from the pTRE3G-BI-Luc control plasmid (Takara Bio) ...
-
bioRxiv - Cancer Biology 2023Quote: Capture antibodies: affinity purified rabbit anti-L1 (anti-ORF1p or anti-ORF2p (RT fragment)) polyclonal antibodies were ordered from GenScript (Custom Polyclonal Antibody Production Service) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Gels were transferred to a PVDF membrane using the eBlot™ L1 Fast Wet Transfer System (GenScript, Piscataway, NJ, USA). Membranes were blocked in 5% non-fat dry milk in 1× TBST rocking for 1hr at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... a biotinylated rat polyclonal antibody against human Fc was used as a capture antibody and anti-human IgG Fc-HRP (GenScript Cat# A01854-200) as a detection antibody ...
-
bioRxiv - Biophysics 2020Quote: ... The codon optimized genes were synthesized for expression in human epithelium kidney cells (HEK293) (GenScript, Piscataway, NJ, USA), but were also found to prone to recombination upon insertion into pCDNA3.1 ...
-
bioRxiv - Molecular Biology 2022Quote: MFcS2: Modified human ACE2 (Sequence-Supplementary Material S1) was codon optimized for HEK293 expression and synthesized from Genscript USA in pUC57 vector ...
-
bioRxiv - Immunology 2022Quote: ... ACE2 fused to human IgG1 Fc domain was gene synthesized (Genscript) and cloned into pCEP4 ...
-
bioRxiv - Biochemistry 2021Quote: ... Primary antibodies (anti-FLAG M2; Sigma and chimeric ACE2-Fc (Genscript; Z03484) were diluted in PBS-BSA to 1 μg mL−1 and added to each imaging dish ...
-
bioRxiv - Immunology 2020Quote: ... Two commercially available ACE2-Fc proteins obtained from Genscript (Cat.No. Z03484-1) and Acrobiosystems (Cat.No ...
-
bioRxiv - Immunology 2023Quote: Antibody binding was also assayed by flow cytometry using CHO-K1 and CHO-K1 Fut8 KO cells transfected with a human PD-1 plasmid (GenScript) by lipofectamine (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... and the S1-Receptor Binding Domain (S1-RBD; Cat. No Z03483; expressed in HEK293 cells) were purchased from by GenScript. The S1-N-terminal domain (S1-NTD ...
-
bioRxiv - Molecular Biology 2020Quote: ... The donor sequence with 700 bp homology arms on each side of the insert site was designed based on the HEK293 reference genome52 and synthesised by GenScript into pUC57-Mini plasmid ...
-
bioRxiv - Biochemistry 2024Quote: ... fused to consecutive C-terminal HA (hemagglutinin)- and FLAG-tags and cloned into pCDNA-3.1 plasmid for expression in HEK293 cells by the CMV (cytomegalovirus) promoter (GenScript Biotech). Mutant variants were generated by site directed mutagenesis (GenScript Biotech).
-
bioRxiv - Immunology 2023Quote: DNA encoding for residues 24-167 of the extracellular portion of human PD-1 (UniProt Q15116) with a C-terminus histidine tag or corresponding PD-1 N58Q mutant were cloned into pcDNA3.4 by GenScript (Piscataway, NJ). Expi293 cells were transiently transfected with plasmid DNA mixed with PEI (Polysciences ...
-
bioRxiv - Biophysics 2020Quote: ACE2-Fc expression vector was generated by subcloning a gene-synthesized cDNA template (GenScript) encoding soluble human ACE2 (amino acid residue 1-738 ...
-
bioRxiv - Bioengineering 2021Quote: Codon-optimized genes for bivalent VHH-Fcs were synthesized and cloned into pTT5 (GenScript; Piscataway ...