-
No products found
because this supplier's products are not listed.
Heather M. Forsythe, et al.,
bioRxiv - Biophysics 2019
Quote:
... The plasmid containing the gene for human γS WT was engineered into the pE-SUMO (Small Ubiquitin-like Modifier) vector containing a N-terminal 6XHis tagged fusion protein (LifeSensors Inc., Malvern, PA). The γS N14D and γS N76D were generated via site-directed mutagenesis using QuikChangeXL Kit (Agilent Technologies ...
-
No products found
because this supplier's products are not listed.
Tania J. Lebratti, et al.,
bioRxiv - Immunology 2020
Quote:
... IL-18 was measured using the mouse IL-18 ELISA kit (MBL International) according to manufacturer’s instructions at half-volumes.
-
No products found
because this supplier's products are not listed.
C. Sahara Khademullah, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Human and mouse Plasma and CSF samples were probed for KCC2 in a mouse SLC12A5 Sandwich ELISA kit (Cedarlane, LS-F65788).
-
No products found
because this supplier's products are not listed.
Jia-Pu Liang, et al.,
bioRxiv - Bioengineering 2020
Quote:
... Dex ELISA kit (Cat. No. 101516; Neogen) and E2 High sensitivity ELISA kit (Cat ...
-
No products found
because this supplier's products are not listed.
Jan-Niklas Tants, et al.,
bioRxiv - Biochemistry 2024
Quote:
... the ZnF was expressed as a fusion construct with an N-terminal Twin-Strep-tag® (IBA Lifesciences, Göttingen) and purified as the other constructs.
-
No products found
because this supplier's products are not listed.
Changjun Yang, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Adropin levels in mouse plasma were quantified using an ELISA kit (Cat. No. EK-032-35, Phoenix Pharmaceuticals, Inc., Burlingame, CA) as recommended by the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Vinny Verma, et al.,
bioRxiv - Biochemistry 2024
Quote:
... was assembled from two synthetic fragments as follows: the N terminal FEN domain of Taq polymerase (with an Asp141Lys mutation (Bio Basic Inc, Canada)) flanked by an EcoRI site and ribosomal binding site (GAATTCTAAAAAGGAGGAAAACAT ...
-
No products found
because this supplier's products are not listed.
Yasuaki Yanagawa, et al.,
bioRxiv - Microbiology 2019
Quote:
... histolytica antibody was detected using a commercially available ELISA kit (Entamoeba histolytica IgG-ELISA; GenWay Biotech, Inc., San Diego, CA. USA). All procedures were performed according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Eunju Im, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Proteins were transferred onto 0.2 µm nitrocellulose membranes (Pall Laboratory, p/n 66485) and the membrane was blocked using 5% non-fat milk or 5% BSA for detecting phospho-proteins ...
-
No products found
because this supplier's products are not listed.
Francisco Inesta-Vaquera, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
Terminal bleeds were collected in heparinized blood collection tubes (Sarstedt). Clinical chemistry assays were performed blind at the clinical pathology laboratory ...
-
No products found
because this supplier's products are not listed.
Dina R. Assali, et al.,
bioRxiv - Neuroscience 2020
Quote:
... n=10 control and n=10 KO were fed formulated chow (Research Diets, D12450K), which had a caloric density of 5.49 kcal/gram and a macronutrient composition of 10% fat ...
-
No products found
because this supplier's products are not listed.
Danielle L. Schmitt, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... equipped with a plan-apochromat 20x/0.8 N/A and 40x/1.4 N/A objectives (Carl Zeiss) and CMOS Orca Flash 4.0 camera (Hamamatsu ...
-
No products found
because this supplier's products are not listed.
Kateřina Kuželová, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... The relative amount of mRNA transcripts was measured by real-time PCR using SensiFAST SYBR N-ROX Kit (Bioline) and calculated by Bio-Rad CFX Manager Software ...
-
No products found
because this supplier's products are not listed.
TM Palhano Zanela, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 0.15% n-dodecylphosphocholine (fos-12; Avanti Polar Lipids) and snap-frozen in liquid N2 ...
-
No products found
because this supplier's products are not listed.
Thomas S. McAlear, Susanne Bechstedt,
bioRxiv - Biophysics 2021
Quote:
... polymerase and inserted into a modified pHAT vector containing an N-terminal 6xHis-tag with and without a carboxy-terminal mNeonGreen (Allele Biotech) followed by a Strep-tag II (Bechstedt and Brouhard ...
-
No products found
because this supplier's products are not listed.
Marina Chan, et al.,
bioRxiv - Systems Biology 2021
Quote:
... Recombinant purified N-terminal domain (NTD) of the SARS-CoV-2 was obtained from Leinco Technologies Inc (Cat #S853 ...
-
No products found
because this supplier's products are not listed.
Josefa Cruz, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... ELISA was performed according to the manufacturer’s instructions using a commercial ELISA kit (Bertin Bioreagents) that detects ecdysone and 20- hydroxyecdysone with the same affinity ...
-
No products found
because this supplier's products are not listed.
MD Fahlberg, et al.,
bioRxiv - Immunology 2020
Quote:
... and Kynurenine ELISA commercial kits (Rocky Mountain Diagnostics, Colorado Springs ...
-
No products found
because this supplier's products are not listed.
Yi-Pin Lin, et al.,
bioRxiv - Microbiology 2020
Quote:
... the ELISA kits to determine the levels of IFNγ and TNFα from house mouse (Mus muscuslus) (Tonbo Bioscience, San Diego, CA) were utilized to detect those cytokines in white-footed mice ...
-
No products found
because this supplier's products are not listed.
Abhishek Phatarphekar, et al.,
bioRxiv - Immunology 2022
Quote:
... N protein was detected using SARS-CoV-2 nucleocapsid antibody (Prosci # 35-579) as primary antibody and goat anti-mouse IgG whole molecule (Sigma # A4416 ...
-
No products found
because this supplier's products are not listed.
Zhiqiang Fu, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... a mouse monoclonal antibody 9FY (N-term epitope KMSPRVPQQDWLSQ; BioCare Medical, Markham, ON) and a mouse monoclonal antibody OTI5F12 (likely an internal epitope since the full 479 aa sequence was used as an antigen ...
-
No products found
because this supplier's products are not listed.
Manuela Leonardelli, et al.,
bioRxiv - Plant Biology 2024
Quote:
... Polyclonal anti-D1 (AS05084A, C-terminal, Agrisera) and anti-RbcL (AS03037 ...
-
No products found
because this supplier's products are not listed.
RE Akhigbe, A.F Ajayi,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
ELISA kits used for the analysis of reproductive hormones were from Monobind Inc. ...
-
No products found
because this supplier's products are not listed.
Zhongliang Jiang, et al.,
bioRxiv - Bioengineering 2022
Quote:
... N,N’-Diisopropylcarbodiimide (DIC, Chem-Impex), N,N’-Dicyclohexylcarbodiimide (DCC ...
-
No products found
because this supplier's products are not listed.
Noelia Perez Diaz, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... bronchi and parenchyma from naïve rats was measured using Rat PPARβ/δ ELISA kit (Abbkine) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Barbara Summers, et al.,
bioRxiv - Pathology 2023
Quote:
... and anti-collagen I and II in mouse BAL was done using a commercially available ELISA on a 96-well plate (Chondrex) and a plate reader ...
-
No products found
because this supplier's products are not listed.
Céline Petitgas, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The primary antibodies used were mouse monoclonal anti-TH (1:1000, cat. n° 22941, ImmunoStar, Hudson, WI, USA) and mouse monoclonal anti-DA (1:100 ...
-
The Mouse Direct PCR Kit provides a fast preparation and PCR amplIFication that is specIFically...
Cat# B40013, SKU# B40013-200rxns,
200rxns, $127.00
Ask
Qing Li, et al.,
bioRxiv - Developmental Biology 2019
Quote:
Mouse tails and AG-haESCs were lysed by Mouse Direct PCR Kit (Bimake) according to the manufacturer’s guidance ...
-
No products found
because this supplier's products are not listed.
Alexia Polissidis, et al.,
bioRxiv - Neuroscience 2021
Quote:
For GBA quantification (n=5 for 4 WPI, n=3 for 8 WPI), the surface function of the Imaris software was used to select only GFP-positive cells by appropriately adjusting the number of voxels as well as the intensity of the GFP channel in the threshold tab ...
-
No products found
because this supplier's products are not listed.
David Hoffmann, et al.,
bioRxiv - Molecular Biology 2021
Quote:
Purification of the mouse lectin-mIgG2a fusion proteins was performed using Protein A agarose resin (Gold Biotechnology, P-400-5). The protein A beads were pelleted at 150g for 5 min and washed once with 1x binding buffer (0.02 M Sodium Phosphate ...
-
No products found
because this supplier's products are not listed.
Nils Stührwohldt, et al.,
bioRxiv - Plant Biology 2020
Quote:
... His6-tagged proteins by a monoclonal mouse α–His6 antibody from Dianova (Hamburg, Germany), and Flag-tagged proteins by α–Flag antibody directly coupled to horseradish peroxidase (Taufkirchen ...
-
No products found
because this supplier's products are not listed.
Drake M. Mellott, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Enrichment of alkyne-modified proteins was conducted using the Click-&-Go Protein Enrichment Kit (Click Chemistry Tools) and the protocols thereof ...
-
No products found
because this supplier's products are not listed.
Natalie Boehnke, et al.,
bioRxiv - Bioengineering 2022
Quote:
... D02-E100-05-N and C02-E100-05-N tangential flow filtration filters were purchased from Repligen. Polystyrene semi-micro cuvettes for the Malvern Zetasizer were purchased from VWR and DTS1070 folded capillary cells were purchased directly from Malvern ...
-
No products found
because this supplier's products are not listed.
Robin-Lee Troskie, et al.,
bioRxiv - Genomics 2021
Quote:
... Protein concentration was measured using the Pierce™ BCA Protein Assay Kit on the POLARstar® Omega microplate reader (BMG Labtech). 7μg of protein lysate was diluted with 4x Laemmli Sample Buffer (BioRad cat # 1610747 ...
-
No products found
because this supplier's products are not listed.
Gianluca Sigismondo, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... the beads were treated with terminal deoxynucleotidyl transferase (EP0162) and biotinylated nucleotides (Biotin-11-dCTP, Jena Bioscience). The beads were then washed with IP buffer (50mM Tris–HCl pH 7.5 ...
-
No products found
because this supplier's products are not listed.
A. Louise Hunter, et al.,
bioRxiv - Physiology 2020
Quote:
... Here the raw data was searched against the mouse Swissprot database (release October 2017) using the paragon algorithm on Protein-Pilot (Version 5.0.1, AB SCIEX). A total of 33847 proteins were searched ...
-
No products found
because this supplier's products are not listed.
Antti M. Salo, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... mouse skin and kidneys using E.Z.N.A total RNA kit I (Omega Bio-Tek) for cells and TRIzol (Invitrogen ...
-
No products found
because this supplier's products are not listed.
David Gonzalez-Perez, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Proteins were separated by SDS-PAGE (12% Mini-PROTEAN TGX Precast Protein Gels, Bio-Rad) and transferred to PVDF membranes using an iBlot2 Gel Transfer Device (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Vincent Loreau, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... modified via an N-terminal and a C-terminal ectopic cysteine with two Biotin-PEG3-Maleimide molecules (Iris Biotech), was bound at 0.6 µg/ml concentration to the sensors until a wavelength shift/binding signal of 0.4 nm was reached ...
-
No products found
because this supplier's products are not listed.
Shun-saku Takahashi, et al.,
bioRxiv - Cell Biology 2019
Quote:
... followed by N-Histofine® simple stain mouse MAX PO kit (NICHIREI BIOSCIENCES, Japan) using 3,3’-diaminobenzidine ...
-
No products found
because this supplier's products are not listed.
Khushali Patel, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... ELISAs were performed using a β-hCG ELISA kit (EIA-1911; DRG International Springfield NJ) and IL-1β ELISA kit (DY401-05 ...
-
No products found
because this supplier's products are not listed.
Maali AlAhmad, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 1,2-bis-(aminophenoxy)- ethane-N,N,N’,N’-tetra-acetic acid-acetoxymethyl ester (BAPTA-AM, P4758, ApexBio), (2- (Dimethylamino)-N-(6-oxo-5,6-dihydrophenanthridin-2-yl)acetamide hydrochloride (PJ34 ...
-
No products found
because this supplier's products are not listed.
Teha Kim, et al.,
bioRxiv - Immunology 2023
Quote:
... and added with mouse C1q protein (Complement Technology) in PBS-T ...
-
No products found
because this supplier's products are not listed.
Nemanja Vuksanovic, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Paratone N (Hampton Research) was used to cryo-protect the crystals before being flash-cooled by plunging in liquid nitrogen.
-
No products found
because this supplier's products are not listed.
Benedikt Graf von Armansperg, et al.,
bioRxiv - Microbiology 2020
Quote:
Protein-protein interactions were detected using the bacteria adenylate cyclase two-hybrid system kit (Euromedex) according to product manuals (Karimova et al. ...
-
No products found
because this supplier's products are not listed.
Xiaonan Zhang, et al.,
bioRxiv - Microbiology 2020
Quote:
... by Abbott AXSYM HBsAg (normal: 0–2S/N) and HBeAg 2.0 MEIA kit (normal: 0–1.0S/CO) (Abbott Laboratories) and for viral load by HBV DNA quantitative real-time PCR kit (Qiagen ...
-
Gliadin ELISA Kit
Cat# EGLD-100,
1.0 kit, 96 tests, USD $519.0
Ask
Anne L. Rosen, et al.,
bioRxiv - Immunology 2023
Quote:
... Total protein in the urine was measured using Quantichrom Total Protein Assay Kit (CAS: QTPR-100, BioAssay Systems) according to the manufacturer’s instructions with samples detected at a 1:4-1:20 dilution ...
-
No products found
because this supplier's products are not listed.
Bhagya M. Dissanayake, et al.,
bioRxiv - Plant Biology 2023
Quote:
Root protein samples were injected (0.5 µg protein) into an online nanoflow (300 nL / min) capillary column (Picofrit with 10μm tip opening / 75μm diameter, New Objective, PF360–75-10-N-5) packed in-house with 15 cm C18 silica material (3 µm ...
-
With the RapidClean protein removal kit, completely remove protein from aqueous solutions of...
Cat# K-01001-010,
10 reactions, USD $145.00/ea
Ask
Ramesh Koirala, et al.,
bioRxiv - Biophysics 2021
Quote:
... Protein samples were detected with a WesternBright Chemiluminescence Kit (catalog no. K-12045; Advansta). Images were acquired using Image Lab software from Bio-Rad.
-
A component of the Papain Dissociation System, for use in the tissue dissociation method of...
Cat# LK003178,
5 vi, $98.00
Ask
Laura M. Chambers, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Total tumor collected per mouse was dissociated using standard methods with a Papain dissociation kit (Worthington Biologicals). Following filtration through a 40 micron filter ...