Labshake search
Citations for Euromedex :
1 - 36 of 36 citations for Mouse Protein N terminal asparagine amidohydrolase NTAN1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: Protein-protein interactions were detected using the bacteria adenylate cyclase two-hybrid system kit (Euromedex) according to product manuals (Karimova et al. ...
-
bioRxiv - Physiology 2023Quote: ... N-(2-Hydroxyethyl)piperazine-N′-(2-ethanesulfonic acid) (HEPES-KOH pH 7.4 20 mM; EuroMedex, 10-110); Sucrose 110mM ...
-
bioRxiv - Microbiology 2021Quote: Genes of interest were PCR-amplified and inserted into KpnI and EcoRI-digested pKNT25 or pUT18 with NEB Hifi Assembly to construct in-frame C-terminal fusions (Euromedex). Plasmids containing T18 and T25 fusions were co-transformed into BACTH test strain BTH101 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 250 ng of Pd(N)6 random hexamers (Euromedex PM-301L). Real-time qPCR of reversed transcribed RNAs was run with SYBR® Green Master Mix (Biorad ...
-
bioRxiv - Microbiology 2021Quote: Gene encoding TurboFP650 was amplified from the plasmid pTurboFP650-N (Evrogen, Euromedex, France) with primers TurboFP650-XbaI 5’TGCTCTTAGATTTAAGAAGGAGATATAGATATGGGAGAGGATAGCGAGCTG3’ and TurboFP650-SphI 5’CATGCATGCTTAGCTGTGCCCCAGTTTGCTAGG3’ ...
-
bioRxiv - Immunology 2023Quote: ... composed of mouse endothelial cell medium with the addition of endothelial cell medium supplement kit (from Cell Biologics, Euromedex) containing fetal bovine serum ...
-
bioRxiv - Microbiology 2023Quote: Protein-protein interactions were evaluated using the Bacterial Two Hybrid System (Euromedex) according to the manufacturer instructions ...
-
bioRxiv - Genomics 2023Quote: ... the slides were immersed in 5X SSC solution overnight (O/N) at RT (Euromedex, EU0300-C). The following day ...
-
bioRxiv - Microbiology 2021Quote: ... before being transferred overnight on a nylon Hybond N+ membrane (Cytiva) in a 20X SSC solution (Euromedex). RNAs were UV crosslinked (120 mJoules ...
-
bioRxiv - Molecular Biology 2022Quote: ... Proteins were loaded on 10% SDS-PAGE gels in parallel with a protein prestained ladder (Euromedex) and transferred onto PVDF membranes (Bio-Rad ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-GFP (1:1000; 2A3, Euromedex) rabbit anti-Calnexin (1:1000 ...
-
bioRxiv - Microbiology 2020Quote: ... Protein expression was induced using 40 μM IPTG (Euromedex) and carried out overnight at 18°C ...
-
bioRxiv - Cell Biology 2022Quote: ... and mouse anti-actin (1:5000; ACT-2D7, Euromedex).
-
bioRxiv - Microbiology 2022Quote: ... the commercially available bacterial two-hybrid kit (BATCH kit, Euromedex) was used [8 ...
-
bioRxiv - Cell Biology 2019Quote: ... and mouse anti-α-tubulin (1:5000, GT114, Cat. #GTX628802, Euromedex). Alexa Fluor conjugated secondary antibodies used ...
-
bioRxiv - Neuroscience 2024Quote: ... Molecular weight were checked using a Prestained Protein Ladder (#06P-0111, Euromedex).
-
bioRxiv - Plant Biology 2021Quote: ... Proteins were transferred on nitrocellulose membrane 0.45 μm in 1xTris-Glycine (Euromedex®), 20%EtOH transfer buffer at 100 V for 1h ...
-
bioRxiv - Cancer Biology 2019Quote: RNA was extracted from homogenized mouse organs or from cells using TRIzol reagent (Euromedex) following the standard protocol ...
-
bioRxiv - Microbiology 2023Quote: Interactions between proteins of interest were screened using the BACTH bacterial two-hybrid system (Euromedex) as described by Karimova et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were separated by migration at 135 V in 1X Tris-Glycine-SDS buffer (Euromedex). Proteins were electro-transferred on a nitrocellulose membrane in 1X Tris-Glycine buffer supplemented with 20% ethanol ...
-
bioRxiv - Immunology 2023Quote: ... between passages 3 and 7 in complete mouse endothelial cell medium (from Cell Biologics, Euromedex) composed of mouse endothelial cell medium with the addition of endothelial cell medium supplement kit (from Cell Biologics ...
-
bioRxiv - Microbiology 2019Quote: Bacterial two-hybrid assays were conducted using the BACTH System kit (bacterial adenylate cyclase two-hybrid system kit, Euromedex). The P ...
-
bioRxiv - Microbiology 2020Quote: Proteins were fractionated by performing SDS-PAGE (12% except where indicated) stained with Coomassie blue (Euromedex, Souffelweyrshim, France). For immunoblot analysis ...
-
bioRxiv - Microbiology 2020Quote: Combinations of the above T18 and T25 fusion proteins were transformed into the BACTH compatible strain BTH101 (Euromedex) for analysis ...
-
bioRxiv - Microbiology 2021Quote: ... and pKNT25 from the BACTH System Kit (Euromedex) using XbaI and KpnI ...
-
bioRxiv - Microbiology 2023Quote: ... the commercially available BACTH kit was used (Euromedex). In brief ...
-
bioRxiv - Physiology 2023Quote: ... genomic DNA was isolated from mouse tail snip using lysis buffer Tris-HCl (EuroMedex, 26-128-3094-B) pH8.5 100mM ...
-
bioRxiv - Molecular Biology 2020Quote: ... for 1h in 37°C and proteins were then digested with Proteinase K (Euromedex, final concentration 0.4 mg/ml) for 2h at 37°C and the temperature was then shifted to 65°C overnight to reverse cross-links ...
-
bioRxiv - Plant Biology 2021Quote: ... Samples migrated on 7.5% (for proteins over 200kDa) or 10% SDS-PAGE polyacrylamide gel at 140V with 1xTris-Glycine SDS running buffer (Euromedex®). Proteins were transferred on nitrocellulose membrane 0.45 μm in 1xTris-Glycine (Euromedex®) ...
-
bioRxiv - Microbiology 2022Quote: ... Equal amounts of GST or GST-Trim69 proteins were then bound to 10 μg of pure porcine brain tubulin (purchased from Euromedex, cat. CS-T240-A) in a total volume of 40 μl of PEM buffer supplemented with 40 μM of Taxol and 1mM GTP ...
-
bioRxiv - Microbiology 2021Quote: The Bacterial Adenylate Cyclase Two-Hybrid System (BACTH System Kit, Euromedex, France) was used to analyze protein–protein interactions ...
-
bioRxiv - Pathology 2021Quote: Total RNA was extracted using the TRI-Reagent kit (Euromedex, Soufflweyersheim, France) and reverse transcription (RT ...
-
bioRxiv - Microbiology 2019Quote: ... BACTH plasmids were made using the Euromedex BACTH System Kit (Euromedex Cat. No. EUK001).
-
bioRxiv - Neuroscience 2020Quote: ... The EasyBlocker kit was used to limit unspecific signal according to the manufacturer’s recommendations (GeneTex, Euromedex, Souffelweyersheim, France). In all cases ...
-
bioRxiv - Biophysics 2020Quote: The PscK-PscDC interaction was tested using the bacterial adenylate-cyclase two-hybrid system (BACTH kit, Euromedex, France) [43 ...
-
bioRxiv - Microbiology 2019Quote: The protein–protein interaction of MC58 FHbp and L91543 FHbp with SecA was investigated using the Bacterial Adenylate Cyclase Two-Hybrid System Kit (Euromedex) according to manufacturer’s instructions ...