-
No products found
because this supplier's products are not listed.
Kari Martyniak, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 5.832g, Oakwood Chemical) were added to the solution under stirring to activate 30 % of the carboxylic acids of the oxidized alginate ...
-
No products found
because this supplier's products are not listed.
James Peak, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and Fluorogold (FG; 3% in saline; Fluorochrome) into the GPe and SNr ...
-
No products found
because this supplier's products are not listed.
Yuma Kato, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and 3 μM CHIR99021 (Focus Biomolecules, USA). On day 2 ...
-
No products found
because this supplier's products are not listed.
Nadya Povysheva, Huiyuan Zheng, Linda Rinaman,
bioRxiv - Neuroscience 2021
Quote:
... adult male Sprague-Dawley rats (n=3; 225-250 g BW) were anesthetized by isoflurane inhalation (1-3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device in the flat skull position ...
-
No products found
because this supplier's products are not listed.
Razieh Rafieenia, et al.,
bioRxiv - Microbiology 2022
Quote:
... Glyphosate concentrations were measured using a glyphosate ELISA kit (Abraxis, Eurofin Technologies, Hungary).
-
No products found
because this supplier's products are not listed.
M. Martinez, et al.,
bioRxiv - Microbiology 2023
Quote:
... at 4°C and loaded 3 times in a CellD disrupter (Constant Systems). The lysate was centrifuged for 15min at 12000 x g at 4°C to remove cell debris and the supernatant was centrifuged again for 1h at 100000 x g at 4°C ...
-
No products found
because this supplier's products are not listed.
Rupa Banerjee, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 6-9 PE-units) and 3-5 mg Silane-PEG-Biotin (Nanocs, 3400 Da) in a solution of 50 mL toluene at 55 °C ...
-
No products found
because this supplier's products are not listed.
Elisa Maritan, et al.,
bioRxiv - Microbiology 2022
Quote:
... and sputter-coated with 3 nm of platinum (Q150T ES, Quorum Technologies Ltd, Ringmer, UK). Alternatively ...
-
No products found
because this supplier's products are not listed.
Kathleen M. Kantak, et al.,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... The 3-inch ballpoint sipper tube with a 1-inch bend (Ancare Corp., Bellmore, NY, USA) protruded 3.6 cm into the chamber ...
-
No products found
because this supplier's products are not listed.
Seren Hamsici, Gokhan Gunay, Handan Acar,
bioRxiv - Bioengineering 2022
Quote:
... Fmoc protected amino acids (Gyros Protein Technologies) were removed through treatment with 20% piperidine/DMF solution for 45 min (three times for 15 min ...
-
No products found
because this supplier's products are not listed.
Shivanand Hegde, et al.,
bioRxiv - Microbiology 2019
Quote:
... 3 min 3% bleach+0.01% Coverage Plus NPD (Steris Corp.), 5 min in 70% ethanol then rinsed three times in sterile water ...
-
No products found
because this supplier's products are not listed.
Lily R. Zehfus, et al.,
bioRxiv - Plant Biology 2021
Quote:
... Quercetin-3-O-glucoside and isorhamnetin-3-O-glucoside were obtained from Indofine Chemical Company ...
-
No products found
because this supplier's products are not listed.
Matiss Maleckis, et al.,
bioRxiv - Bioengineering 2024
Quote:
... and 10 μM Hexakis (2, 2, 3, 3-tetrafluoropropoxy) phosphazene (Apollo Scientific Ltd., Cheshire, UK) as lock masses ...
-
No products found
because this supplier's products are not listed.
KM Hudock, et al.,
bioRxiv - Immunology 2022
Quote:
... 100mU/ml human NE protein (Athens Research & Technology #16-14-051200, ART), 100μU/ml human PR3 protein (ART #16-14-161820 ...
-
No products found
because this supplier's products are not listed.
Megan L. Schaller, et al.,
bioRxiv - Physiology 2024
Quote:
... Samples were incubated in 3% acetic acid for 3 minutes followed by Alcian Blue (Newcomer Supply, 1003A) for 30 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Roman Franěk, et al.,
bioRxiv - Zoology 2019
Quote:
... and 3 μl PCR H2O (Top-Bio). Reaction conditions were 30 cycles of 94 °C for 30 s ...
-
No products found
because this supplier's products are not listed.
Alena Aliashkevich, et al.,
bioRxiv - Microbiology 2020
Quote:
3 gr of seeds (e.g. Medicago sativa) were mashed and soaked in 10 mL of water overnight followed by centrifugation at 5,000 rpm to remove the particulate fraction ...
-
No products found
because this supplier's products are not listed.
Minh Dao Ngo, et al.,
bioRxiv - Immunology 2022
Quote:
... 3 mL aminopropyl SPE columns (Biotage; Charlotte, NC). The samples were dissolved in 1 ml of hexane and transferred to the SPE column ...
-
No products found
because this supplier's products are not listed.
Stephen Meek, et al.,
bioRxiv - Immunology 2021
Quote:
... 25 ng/ml rpIL-3 (Kingfisher Biotech, #RP1298S). Attached EBs were fed every 4 days with Macrophage Induction medium ...
-
No products found
because this supplier's products are not listed.
Rachel Grazda, et al.,
bioRxiv - Immunology 2023
Quote:
200μL fluorescent Dil (DilC18(3))-labeled liposomes (Liposoma) were administered to mice via retro-orbital I.V ...
-
No products found
because this supplier's products are not listed.
Kiryu K. Yap, et al.,
bioRxiv - Cell Biology 2023
Quote:
Human coagulation factor VIII levels in the mouse plasma were measured using a factor VIII enzyme-linked immunosorbent assay (ELISA) kit (Affinity Biologicals), following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Thomas M. Winkelmüller, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 800 µl of 3 µM flg22 (EZBiolab Inc., USA) solution was added to the medium containing the seedlings resulting in a final concentration of 1 µM flg22 ...
-
No products found
because this supplier's products are not listed.
Zhiyi Liu, et al.,
bioRxiv - Immunology 2022
Quote:
... NIH/3T3 SMAD2/3-luciferase reporter cell line (Signosis) was co-cultured with BALF ...
-
No products found
because this supplier's products are not listed.
Chiaki Imanaka, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3% bovine serum albumin (BAC62, Equitech-Bio, Kerrville, TX), and 0.02% polyoxyethylene sorbitan monolaurate (166–21115 ...
-
No products found
because this supplier's products are not listed.
Jaqueline S. Generoso, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rabbit polyclonal anti-capsule serotype 3 antiserum (SSI Diagnostica) followed by Alexa Fluor 594 goat anti-rabbit (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
James T. McKenna, et al.,
bioRxiv - Neuroscience 2020
Quote:
Mice were deeply anesthetized with isoflurane (1-3%) and viral injections were performed using a 1 µl Hamilton syringe (Cat#7001KH, Point Style 3, Hamilton Company, Reno, NV, USA), targeting BF (AP +0.14 mm ...
-
No products found
because this supplier's products are not listed.
Colin L. Hisey, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... a pooled digest (3 µg of protein from the fifteen 15 µg samples) was applied to an SCX MicroSpin column (The Nest Group, Inc.) according to manufacturer’s instructions and fractionated using 50 mM ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Michelle Zuo, et al.,
bioRxiv - Immunology 2021
Quote:
... magnetic beads were conjugated with monoclonal capture antibodies (mAB47:3, UmanDiagnostics), incubated with diluted mouse serum (1:8 or 1:16 dilution ...
-
No products found
because this supplier's products are not listed.
Sara C. Di Rienzi, et al.,
bioRxiv - Microbiology 2022
Quote:
... 3-inch needle (N163D, Air-Tite Vet Premium Hypodermic Needles, USA) positioned at the level within the glass reactor such that the media level was at 15 mls ...
-
No products found
because this supplier's products are not listed.
Prashant Gupta, et al.,
bioRxiv - Bioengineering 2022
Quote:
... in 3 ml of Hibernate E-Ca (HE-Ca, BrainBits, USA) for 10 minutes at 30°C ...
-
No products found
because this supplier's products are not listed.
Jiahn Choi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 3′-diaminobenzidine (DAB) for visualization of the antigen-antibody complex (Scytek).
-
No products found
because this supplier's products are not listed.
Ana Rita Dias Araujo, et al.,
bioRxiv - Biochemistry 2024
Quote:
... and 3 µg standards (manually mixed, Avanti Polar Lipids® and Sigma-Aldrich®; BVO from Spectrum Chemical®) onto a Merck HPTLC glass plate silica gel 60 (20×10cm ...
-
No products found
because this supplier's products are not listed.
Selena Y. Lin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... PG donors 3 and 4 had only plasma obtained by Lee Biosolution. In this case ...
-
Cat# IMS206_Giardia-3X,
USD $1980.0/kit
Ask
Remigiusz A. Serwa, et al.,
bioRxiv - Microbiology 2019
Quote:
... monoclonal mouse anti-VP5 capsid protein(1:2500, Virusys) and rabbit anti-gE/I anti-sgE/I envelop protein (1:1000 ...
-
No products found
because this supplier's products are not listed.
Aly Elezaby, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Serum lactate dehydrogenase level was measured at 3 days after MI by commercially available kit following manufacturer’s instructions (Eton Bioscience, San Diego, CA, USA). Fractional shortening was determined under basal conditions and after isoproterenol stimulation (10μg/kg ...
-
No products found
because this supplier's products are not listed.
Eileen M. Lynch, et al.,
bioRxiv - Pathology 2024
Quote:
... Amplified samples were run on a 2% agarose gel (Lamda Biotech, Inc., A113-3) containing 0.5μg/mL ethidium bromide (Millipore Sigma ...
-
No products found
because this supplier's products are not listed.
Allison M. Owen, et al.,
bioRxiv - Immunology 2022
Quote:
Fresh buffy coat samples collected in EDTA from healthy male donors (age range 22-56; 14% Caucasian, 57% Hispanic, and 14% Black) were purchased from BioIVT. Samples were collected under IRB-approved protocols and were shipped the same day of collection ...
-
No products found
because this supplier's products are not listed.
Pooja Gupta, et al.,
bioRxiv - Biochemistry 2021
Quote:
... An initial crystallization condition was identified I the Wizards Classic 3&4 crystallisation screen (Rigaku), well F2 (40% PEG400 ...
-
No products found
because this supplier's products are not listed.
Yuyan Cheng, et al.,
bioRxiv - Neuroscience 2020
Quote:
... cholera toxin B subunit (CTB, 3 µl/eye, 2 µg/µl, List Biological Laboratories, Inc., 103B) was injected intraocularly as an anterograde tracer to label axons regenerating through the optic nerve.
-
No products found
because this supplier's products are not listed.
Lucy Chou-Zheng, Asma Hatoum-Aslan,
bioRxiv - Microbiology 2019
Quote:
... The most concentrated fractions (3 ml total) were pooled and mixed with SUMO Protease (MCLAB, CA, USA) and provided SUMO buffer (salt-free) ...
-
No products found
because this supplier's products are not listed.
Surya Cayre, et al.,
bioRxiv - Developmental Biology 2020
Quote:
The following primary antibodies were used on mouse cell-derived lysates: anti-mouse milk proteins (Accurate Chemical; YNRMMSP; 1/2000), anti-mouse b-casein (a kind gift from C ...
-
No products found
because this supplier's products are not listed.
Laura N. Puentes, et al.,
bioRxiv - Neuroscience 2020
Quote:
... BioPORTER Protein Delivery Reagent “QuikEase Kit” (Genlantis, Cat#BP502424) was prepared according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Brynna S. Eisele, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The volume of concentrated samples was adjusted to 70 ul and 3 ul of Chondroitinase ABC (1.4 U/ml Stock solution, containing BSA, Seikagaku) was added to each sample ...
-
No products found
because this supplier's products are not listed.
Nobuyuki Oguri, et al.,
bioRxiv - Pathology 2023
Quote:
... and 50 mM HEPES-NaCl (pH 7.4) with 3 mM H-D-isoleucyl-L-prolyl-L-arginine-p-nitroaniline dihydrochloride (Chromogenix S-2288, Diapharma).
-
No products found
because this supplier's products are not listed.
Cecilia S. Blengini, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Internal control Reverse: 5’ - GTAGGTGGA AATTCTAGCATCATC C- 3’) were used at 20 pMol using FastMix French PCR beads (Bulldog Bio, #25401) following manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Matthäus Mittasch, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Protein-Free (Expression Systems), supplemented with Fetal Bovine Serum (2% final concentration).
-
No products found
because this supplier's products are not listed.
E.A. Rosado-Olivieri, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... mouse J2 dsRNA (SCICONS; 1;1,000), phospho Histone H3 (Cell Signaling ...
-
No products found
because this supplier's products are not listed.
Mélanie Roussat, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... γ-Tubulin (Exbio, 1:1000, mouse), CTIP2 (abcam ...
-
No products found
because this supplier's products are not listed.
Caio A. C. G. Brunharo, et al.,
bioRxiv - Genomics 2023
Quote:
... A Hi-C Plant Kit (Phase Genomics, Seattle, WA) was used to create a proximity ligation library that included four restriction enzymes (DpnII ...