-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... A Mouse Relaxin-3 ELISA Kit was purchased from Signalway Antibody LLC (MD ...
-
No products found
because this supplier's products are not listed.
Stephen W. Wietgrefe, et al.,
bioRxiv - Immunology 2022
Quote:
... Supernatant p24 was measured on day 14 by ELISA (Zeptometrix) per manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Takuma Hayashi, Motoki Ichikawa, Ikuo Konishi,
bioRxiv - Immunology 2022
Quote:
... cTnT ELISA: Serum cTnT levels were determined with mouse cTnT ELISA Kit (CUSABIO TECHNOLOGY LLC, Houston, TX, USA) according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Danilo Correa Pinto Junior, et al.,
bioRxiv - Physiology 2023
Quote:
... Mouse circulating osteocalcin was measured by ELISA (Quidel kit Cat #60-1305). Blood testosterone levels were determined by RIA (Testo-US Cisbio Bioassays) ...
-
No products found
because this supplier's products are not listed.
Ranjie Xu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... CHIR99021 (3 mM, Biogems), human leukemia inhibitory factor (hLIF ...
-
No products found
because this supplier's products are not listed.
Shinya Komata, et al.,
bioRxiv - Genetics 2022
Quote:
... by QuantStudio 3 (ABI). The detailed method was followed by Iijima et al ...
-
No products found
because this supplier's products are not listed.
Zhi Liu, et al.,
bioRxiv - Physiology 2022
Quote:
... and rectal probe (Kent Scientific, RET-3). Before recording temperatures ...
-
No products found
because this supplier's products are not listed.
Jessie Benedict, et al.,
bioRxiv - Neuroscience 2024
Quote:
... each mouse began receiving subcutaneous injections of the hM4Di agonist called Agonist-21 (HelloBio, dose: 3 mg/kg, HB4888) every 6 hours (0900 ...
-
No products found
because this supplier's products are not listed.
Ann Schirin Mirsanaye, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... diluting 3 μl of protein sample (20 nM) in 15 μl PBS buffer loaded on a gasket (Grace Bio-Labs reusable CultureWell gaskets (GBL103250 ...
-
35 mm dish with 14mm micro-well without cover slip.
Cat# D35-14,
100/case, $65.00
Ask
Dingchang Lin, et al.,
bioRxiv - Neuroscience 2021
Quote:
... or 14 mm glass bottom dishes (CellVis, D35-14-1.5-N) coated with 40 μg/ml poly-L-lysine-coated (P8920 ...
-
No products found
because this supplier's products are not listed.
Ana S Almeida, et al.,
bioRxiv - Microbiology 2021
Quote:
... and three 3–4 mm sterile glass beads (Biospec Products). Next ...
-
No products found
because this supplier's products are not listed.
Eva Jarc Jovičić, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 500 nM BHT and IS (8 pmol 18:3/18:3/18:3 triacylglycerol, 14:0/14:0 phosphatidylcholine, Larodan, Solna ...
-
No products found
because this supplier's products are not listed.
Bas W.A. Bögels, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide HCl (EDC, Carbosynth), 1,6-diaminohexane (Sigma ...
-
No products found
because this supplier's products are not listed.
Sybille Koehler, et al.,
bioRxiv - Cell Biology 2020
Quote:
Urinary albumin levels were measured with a mouse albumin ELISA kit (ICL/Dunn Labortechnik GmbH ...
-
No products found
because this supplier's products are not listed.
Marine Tessier, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and the Mouse Interleukin 10 ELISA Kit (Biosensis®, BEK-2046-1P)
-
No products found
because this supplier's products are not listed.
Sytse J. Piersma, et al.,
bioRxiv - Immunology 2020
Quote:
... and host Actb (Forward: 5’-AGCTCATTGTAGAAGGTGTGG-3’; Reverse: 5’ - GGTGGGAATGGGTCAGAAG-3’; Probe: 5’-TTCAGGGTCAGGATACCTCTCTTGCT-3’; IDT DNA) against plasmid standard curves using TAQman universal master mix II on a StepOnePlus real time PCR system (Thermo Fisher Scientific).
-
No products found
because this supplier's products are not listed.
Yu Wang, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... the dCas9 protein was quantified using the CRISPR/Cas9 assay ELISA kit (Epigentek).
-
No products found
because this supplier's products are not listed.
Donggi Paik, et al.,
bioRxiv - Immunology 2021
Quote:
... 3-oxoLCA (Steraloids (C1750-000 ...
-
No products found
because this supplier's products are not listed.
Alan Bush, et al.,
bioRxiv - Neuroscience 2021
Quote:
... strips with 54 or 63 contacts each (platinum 1 mm disc contacts arranged in a 3×18 or 3×21 layout, with 3 mm center to center spacing, PMT Cortac Strips models 2110-54-001 and 2011-63-002 ...
-
No products found
because this supplier's products are not listed.
Lorine Debande, et al.,
bioRxiv - Microbiology 2023
Quote:
... and 3% BSA (Euromedex). A horseradish peroxidase-conjugated goat anti-rabbit IgG antibody (Abcam ...
-
No products found
because this supplier's products are not listed.
Thorsten B. Blum, et al.,
bioRxiv - Biophysics 2020
Quote:
... and vortexed for a few minutes in an Eppendorf tube with a 3/32” PTFE bead (Smart Parts) for insulin and 2.381 mm PTFE MicroSeed beads (Molecular Dimensions, MD2-14) for thaumatin and thermolysin ...
-
No products found
because this supplier's products are not listed.
Ahmed Ali, et al.,
bioRxiv - Biophysics 2023
Quote:
... and sequentially in 1:3 dilution steps added to the wells of PEG-BSA coated ELISA plates (PBSA20PL, Life Diagnostics, Inc.) The plates were incubated for 2 h at RT to allow antibody binding ...
-
No products found
because this supplier's products are not listed.
Furong Ju, et al.,
bioRxiv - Neuroscience 2022
Quote:
Each mouse was anesthetized by inhalation of 1.5–3% isoflurane (RWD Life Science, Shenzhen, China) in 100% O2 and placed on a stereotactic stage (RWD Life Science ...
-
Doxorubicin, Hydrochloride Salt (Adriacin, Adriamycin, Adriblastin, Adriblastina, Dox, Doxil, Farmiblastina, 14-Hydroxydaunomycin, 14-Hydroxydaunorubicine, FI-106, Lipodox, Myocet, NSC-123127, Rubex, CAS 25316-40-9), >99%
LC Laboratories' Product Number D-4000 - Doxorubicin, Hydrochloride Salt (Adriacin, Adriamycin,...
Cat# D-4000, SKU# D-4000_10g,
10 g, $1590.00
Ask
Rohan N. Shah, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 3 µM CHIR99021 (LC Laboratories), 1 µM PD0325901 (LC Laboratories) ...
-
No products found
because this supplier's products are not listed.
Emilia Neuwirt, et al.,
bioRxiv - Immunology 2022
Quote:
... 3 - 5 μM MCC950 (Adipogen), 50 - 200 nM MG132 (Sigma) ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, James A. Van Deventer,
bioRxiv - Synthetic Biology 2021
Quote:
... 3-Amino-L-tyrosine (Bachem), 4-Amino-L-phenylalanine (Bachem) ...
-
No products found
because this supplier's products are not listed.
C. Sahara Khademullah, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Human and mouse Plasma and CSF samples were probed for KCC2 in a mouse SLC12A5 Sandwich ELISA kit (Cedarlane, LS-F65788).
-
No products found
because this supplier's products are not listed.
Tomoki Togashi, et al.,
bioRxiv - Bioengineering 2023
Quote:
... hPC antigen (hPC:Ag) was measured using the Human Protein C AssayMaxTM ELISA Kit (Assaypro, St. Charles, MO) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Timur O Yarovinsky, et al.,
bioRxiv - Immunology 2019
Quote:
... We used HBsAg ELISA kit from XpressBio and the HBsAg standard from CellBioLabs to measure serum HBsAg in the chronic HBV infection model.
-
No products found
because this supplier's products are not listed.
CY Wang, et al.,
bioRxiv - Systems Biology 2024
Quote:
... Cells were harvested on Day 3 using Direct-zol RNA MiniPrep kit (Cambridge Bioscience, R2052).
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
No products found
because this supplier's products are not listed.
Ivan Corbeski, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 3 nM XL665-conjugated streptavidin (Cisbio, 610SAXLB), 1x anti-GST Eu3+-labelled antibody (from 400x stock (Cisbio ...
-
No products found
because this supplier's products are not listed.
Brandon S. Johnson, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and a 3 hr Solusol (National Diagnostics) digestion to dissolve the cell wall fraction ...
-
No products found
because this supplier's products are not listed.
Lingya Yao, et al.,
bioRxiv - Plant Biology 2022
Quote:
... The α-GFP antibody (Abmart) was used to detect the NPR1-YFP protein and α-Histone 3 antibody (Agrisera) was used to detect Histone 3 (as loading control) ...
-
No products found
because this supplier's products are not listed.
Iris Lindberg, et al.,
bioRxiv - Neuroscience 2021
Quote:
... via a 30-gauge 10 µL Hamilton syringe (Hamilton 701SN-30/3’/3) mounted on a motorized injector (Stoelting QSI). After each injection ...
-
No products found
because this supplier's products are not listed.
Luca A. Andronico, et al.,
bioRxiv - Biophysics 2024
Quote:
... 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC) and 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC)) were purchased from Bangs Laboratories and Avanti Polar Lipids ...
-
No products found
because this supplier's products are not listed.
Koki Ueda, et al.,
bioRxiv - Developmental Biology 2023
Quote:
Serum vitamin D (25(OH)D) levels of mouse serum samples were assessed by commercially available ELISA kits (Eagle Biosciences, Inc ...
-
No products found
because this supplier's products are not listed.
Kazuhide Yahata, et al.,
bioRxiv - Microbiology 2021
Quote:
... Slides were subsequently blocked overnight in PBS containing 3% BSA before labelling with anti-mNeonGreen mouse monoclonal antibody (32F6; 1:300; Chromotek, Germany) followed by Alexa Fluor 488 goat anti-mouse antibody (1:1000 ...
-
No products found
because this supplier's products are not listed.
Michael H. Myoga, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 3 mm tip-diameter reusable feeding needle (Fine Science Tools), operated using a normally closed pinch valve (NResearch ...
-
No products found
because this supplier's products are not listed.
Vasilisa Aksenova, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Analysis of localization and expression of targeted proteins in clones were performed after 14- to 20-day period post transfection on a 24-well lumox (Sarstedt) plates ...
-
No products found
because this supplier's products are not listed.
Dmitry Shvarev, et al.,
bioRxiv - Biochemistry 2023
Quote:
... ATTO488-1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine (ATTO488) was obtained from ATTO-TEC GmbH (Siegen ...
-
No products found
because this supplier's products are not listed.
Zhouyi Rong, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Mouse Interferon Gamma Induced Protein 10kDa (IP10) ELISA Kit (RD-IP10-Mu, Reddot biotech) were used in this study.
-
No products found
because this supplier's products are not listed.
Tania Ray, et al.,
bioRxiv - Cell Biology 2020
Quote:
... The MSC medium was changed every 3 days for 14 days following which Alkaline Phosphatase Assay (Anaspec EGT, Catalog # AS-72146) was used to assess mesenchymal stem cell activity according to manufacturer’s instructions and cell pellets were preserved for further downstream analyses.
-
No products found
because this supplier's products are not listed.
VA Brentville, et al.,
bioRxiv - Immunology 2023
Quote:
... N protein was detected using the SARS-CoV-2 NP ELISA kit from Bioss (cat# BSKV0001) according to the supplier’s instructions ...
-
No products found
because this supplier's products are not listed.
F Abou Azar, et al.,
bioRxiv - Biochemistry 2022
Quote:
... were isolated from wildtype mice or transgenic mice over-expressing a TAP-tagged 14-3-3ζ that were fed a low-fat (LFD) or 60% high-fat diet (HFD; Research Diets, New Brunswick, NJ) for 12 weeks (24) ...
-
No products found
because this supplier's products are not listed.
Susanne Wiemann, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 3 % goat serum (Dianova, Hamburg, Germany), and 0.5 % Triton™-X-100 (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Tiesuo Zhao, et al.,
bioRxiv - Immunology 2024
Quote:
... cleaved-caspase 3 (1:1000, Bioworld), Pro-Caspase 3 (1:2000 ...
-
Mouse 14-3-3 protein sigma (SFN) ELISA Kit is an ELISA Kit for the in vitro quantitative...
Cat# abx556082-96T,
96 tests USD $717.75
Ask
M Hazime, et al.,
bioRxiv - Neuroscience 2022
Quote:
GABA concentrations in the extracellular medium of astrocytes was determined using the Mouse GABA ELISA Kit (Abbexa, Ltd.) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Omer Adir, et al.,
bioRxiv - Bioengineering 2021
Quote:
... The protein containing fractions were dialyzed in a 12-14 kD membrane (Spectrum Laboratories, USA) against their original resuspension buffer.
-
No products found
because this supplier's products are not listed.
Li Zhenyu, Li Tian, Liu Meisui, Ivanovic Tijana,
bioRxiv - Microbiology 2022
Quote:
... sn-(1-oleoyl-2-hydroxy)-glycerol-3-phospho-sn-3′-(1′-oleoyl-2’-hydroxy)-glycerol (ammonium salt) (18:1 BMP (R,R); Avanti Polar Lipids) ...