-
No products found
because this supplier's products are not listed.
Maxime De Rudder, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Factor V serum protein concentration was assessed by ELISA following manufacturer’s instructions (Mouse factor V ELISA kit orb409284, Biorbyt).
-
No products found
because this supplier's products are not listed.
Thomas J. Cahill, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... Macrophages were incubated with 3 ug/mL biotinylated Hyaluronan binding protein (Amsbio) overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Samantha A. Scott, Jingjing Fu, Pamela V. Chang,
bioRxiv - Microbiology 2023
Quote:
... Indole-3-aldehyde (I3A) and indole-3-pyruvate (IPyA) were obtained from Biosynth. Tryptophol (IEt) ...
-
No products found
because this supplier's products are not listed.
F Abou Azar, et al.,
bioRxiv - Biochemistry 2022
Quote:
... were isolated from wildtype mice or transgenic mice over-expressing a TAP-tagged 14-3-3ζ that were fed a low-fat (LFD) or 60% high-fat diet (HFD; Research Diets, New Brunswick, NJ) for 12 weeks (24) ...
-
No products found
because this supplier's products are not listed.
Vanesa Fernández-Majada, et al.,
bioRxiv - Cell Biology 2021
Quote:
... CHIR99021 (3 µM, Tebu-bio) and valproic acid (1 mM ...
-
No products found
because this supplier's products are not listed.
Mayuka Katagiri, et al.,
bioRxiv - Immunology 2024
Quote:
... PE anti-mouse CD62L (clone MEL-14, Tonbo Biosciences, 1:100), FITC anti-mouse CD86 (clone GL-1 ...
-
No products found
because this supplier's products are not listed.
Wei-Chun Chang, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... a cortisol ELISA kit (Salivary Cortisol Enzyme Immunoassay Kit, Salimetrics) was used according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Vladimir Girik, et al.,
bioRxiv - Cell Biology 2023
Quote:
3 μm carboxyl polystyrene beads (Spherotech, CP30-10) were covalently coupled with purified human IgG (hIgG ...
-
No products found
because this supplier's products are not listed.
Kouhei Yoshida, et al.,
bioRxiv - Bioengineering 2023
Quote:
The AAV Titration ELISA Kit series (PROGEN Biotechnik GmbH) was used to quantify AAV capsid titers depending on the AAV serotype ...
-
No products found
because this supplier's products are not listed.
Chao Gao, et al.,
bioRxiv - Biochemistry 2020
Quote:
... for 3 min and separated on a C18 analytical column (picofrit 75 μm ID x 150 mm, 3 μm, New Objective) using a linear gradient of 2 % to 45 % solvent B (80% acetonitrile ...
-
No products found
because this supplier's products are not listed.
Joshua D. Powell, et al.,
bioRxiv - Microbiology 2024
Quote:
... ELISA (IDEXX) and HI assays were performed on serum from contact pigs at 17 dpc to determine if IAV-specific antibodies were present to indicate virus transmission.
-
No products found
because this supplier's products are not listed.
Hui Huang, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 1-3 million nuclei were sonicated in 130μl microtube by Covaris M220 instrument (Power ...
-
No products found
because this supplier's products are not listed.
Pablo Hurtado, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... measuring the fluorescent signal after a 3 hour incubation using FLUOstar OPTIMA (BMG Labtech) plate reader.
-
No products found
because this supplier's products are not listed.
Yan Wang, et al.,
bioRxiv - Microbiology 2021
Quote:
Sulforaphane (SFN) (LKT Laboratories, S8044) was bought from MedChem Express and diluted with dimethyl sulfoxide (DMSO) ...
-
No products found
because this supplier's products are not listed.
Tianyang Mao, et al.,
bioRxiv - Immunology 2021
Quote:
The triphosphorylated RNA oligonucleotides SLR-14 (5′ pppGGAUCGAUCGAUCGUUCGCGAUCGAUCGAUCC-3′ and SLR-14-amino (5′ pppGGAUCGAUCGAUCGUXCGCGAUCGAUCGAUCC-3′ where X = aminomodifier C6dT; Glen Research) were prepared as described57 ...
-
No products found
because this supplier's products are not listed.
Clara Taffoni, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... cGAMP enzyme-linked immunosorbent assay (ELISA) was performed according to the manufacturer’s protocol using the Cayman Chemical 2′3′-cGAMP ELISA Kit (Bertin Bioreagents).
-
No products found
because this supplier's products are not listed.
Evelyn Ploetz, et al.,
bioRxiv - Biophysics 2020
Quote:
... The radio-labelled compounds [3 H]-asparagine and [14 C]-glutamine were obtained from American Radiolabeled Chemicals and PerkinEllmer ...
-
No products found
because this supplier's products are not listed.
Luciana Galetto, et al.,
bioRxiv - Microbiology 2020
Quote:
... together with 3 μL of Sharpmass VI Prestained Protein Marker (EuroClone) and 5 μL of Unstained SDS-PAGE Standards ...
-
No products found
because this supplier's products are not listed.
Rebekka Karlowitz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... mouse anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (5G4cc, HyTest, Turku, Finland), mouse anti-Vinculin (#V9131-100UL ...
-
No products found
because this supplier's products are not listed.
Pauline Bohne, et al.,
bioRxiv - Neuroscience 2023
Quote:
... connected to the ‘Brain Infusion Kit 3’ (#0004760, Durect). Pumps were prepared sterilely according to the manual ...
-
No products found
because this supplier's products are not listed.
Lijin Zou, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... The human proteins were assigned to 3 Piggybac vectors (System Biosciences, USA) by Golden Gate Assembly method (11 ...
-
No products found
because this supplier's products are not listed.
Safwan K. Elkhatib, et al.,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... and plasma were assessed using 3-CAT research ELISA (Rocky Mountain Diagnostics, BAE-5600, Colorado Springs, CO, USA) which had a corrected NE lower limit of detection of 30 pg/mL ...
-
No products found
because this supplier's products are not listed.
Lauriane Cornuault, et al.,
bioRxiv - Physiology 2022
Quote:
... and mouse anti-total PLN (Badrilla, Cat# A010-14).RYR2 phosphorylation was evaluated by SDS PAGE using rabbit anti-phosphoRYR2 antibodies (Badrilla ...
-
No products found
because this supplier's products are not listed.
Steffi Daniel, John D. Hulleman,
bioRxiv - Neuroscience 2022
Quote:
... fibulin-3 blocking peptide (5:1 to anti-fibulin-3 antibody, Prosci # 5213P). The next day ...
-
No products found
because this supplier's products are not listed.
Nicholas G. Lamson, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 1-Ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) was purchased from Chem-Impex. Falcon cell strainer tubes were purchased from Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Alvina I. Khamidullina, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Primers CDKN1B-forv 5’-attagctagcATGTCAAACGTGCGAGTGTCTAA-3’ and CDKN1B-rev 5’-taatggatccTTACGTTTGACGTCTTCTGAGGC-3’ (Evrogen, Moscow, Russia) containing NheI and BamHI restriction sites were used for amplification ...
-
No products found
because this supplier's products are not listed.
Mingqi Zhou, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 3 U APEX Taq (Genesee Scientific), and molecular-grade H2O to bring the total volume to 35 μl.
-
No products found
because this supplier's products are not listed.
Md. Golam Kibria, et al.,
bioRxiv - Biophysics 2022
Quote:
... 200 μL of protein samples in a 3-mm optical path length quartz cuvette (T-507, TOSOH, Japan) was used for the measurements ...
-
No products found
because this supplier's products are not listed.
Jimmy Zhang, et al.,
bioRxiv - Physiology 2021
Quote:
... The antibodies used for immunostaining and ELISA were mouse anti-Meth antibody (mouse, 10M25A Fitzgerald), anti-MBD2 (ab45027 ...
-
To help researchers in the global fight against the coronavirus, abm has developed an RT-qPCR...
Cat# G628,
100 Rxns/kit, please contact supplier for pricing.
Ask
Charles E. Norton, et al.,
bioRxiv - Physiology 2020
Quote:
... and audible baseline monitor (model ABM-3, WPI) as previously described27 ...
-
No products found
because this supplier's products are not listed.
Ada Nowosad, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Lysates (500 µg for HEK293 or 2 mg for U251N) were incubated with 3 µg of indicated antibodies and 12 µl protein-A sepharose beads (IPA300, Repligen) (co-IP ...
-
No products found
because this supplier's products are not listed.
Watcharachai Meemetta, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Forward primer LCHV-MEP93-qF: 5’-GTACTTCATCGCCTACGGAGC-3’ and reverse primer LCHV-MEP93-qR: 5’-TACGTGTGCTTGAGGAGGTC-3’ were synthesized from Bio Basic, Canada ...
-
No products found
because this supplier's products are not listed.
Hanyue Cecilia Lei, et al.,
bioRxiv - Neuroscience 2023
Quote:
... mice fed ad libitum were given 3 g/mouse of the reward sugar pellet (Dustless Precision Pellet, F0071, Bio-Serv) on the bedding of their home cages when cages were changed at ZT12 ...
-
No products found
because this supplier's products are not listed.
Changjun Yang, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Adropin levels in mouse plasma were quantified using an ELISA kit (Cat. No. EK-032-35, Phoenix Pharmaceuticals, Inc., Burlingame, CA) as recommended by the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Linlin You, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... coli TTC-pause at 13 mg/mL was incubated with 3-([3-cholamidopropyl] dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, 8 mM, final concentration; Hampton Research Inc.) prior to grid preparation ...
-
No products found
because this supplier's products are not listed.
Astrid Kollewe, et al.,
bioRxiv - Biochemistry 2021
Quote:
... manually packed 11 cm (AP-MS) or 23 cm (csBN-MS) with ReproSil-Pur 120 ODS-3 (C18; particle size 3 µm; Dr. Maisch HPLC, Germany) and electrosprayed (2.3 kV ...
-
No products found
because this supplier's products are not listed.
Angelino T. Tromp, et al.,
bioRxiv - Microbiology 2020
Quote:
... Samples were checked for purity and presence of protein using 15% SDS-PAGE (Polyacrylamide gel electrophoresis, Mini Protean 3 System, Bio-Rad) and Coomassie Brilliant Blue (Merck ...
-
No products found
because this supplier's products are not listed.
Zhexin Wang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 3 times at 10,000 rpm for 5 s (IKA TC10 basic ULTRA-TURRAX® homogenizer with S10N-5G dispersing element ...
-
No products found
because this supplier's products are not listed.
Aya M. Saleh, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 5 mM tris(3-hydroxypropyltriazolylmethyl)amine (THPTA; Click Chemistry Tools), 2 mM copper sulfate ...
-
No products found
because this supplier's products are not listed.
John Heath, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... at 1:3 ratio and spread over the CometSlide (Trevigen). Slides were dried at room temperature for 2 minutes and immersed into neutral lysis buffer overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Yasuaki Yanagawa, et al.,
bioRxiv - Microbiology 2019
Quote:
... histolytica antibody was detected using a commercially available ELISA kit (Entamoeba histolytica IgG-ELISA; GenWay Biotech, Inc., San Diego, CA. USA). All procedures were performed according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Valerie Le Sage, et al.,
bioRxiv - Microbiology 2019
Quote:
... mouse anti-Matrix Protein (Kerafast, Inc.; EMS009) or goat anti-Influenza A Virus (Abcam ...
-
No products found
because this supplier's products are not listed.
Ian Hoskins, et al.,
bioRxiv - Genomics 2023
Quote:
gDNA was extracted from approximately 3-4 million cells with the Cell and Tissue DNA Isolation Kit (Norgen Biotek Corp, 24700), including RNaseA treatment at 37 °C for 15 min ...
-
WB,ELISA
Cat# A5434, SKU# A5434-100ul,
100ul, $157.00
Ask
Yi Ran, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... cell extracts (3 ml of the supernatant) were incubated with Anti-Flag Affinity Gel (Bimake) at 4 °C for 3 h ...
-
No products found
because this supplier's products are not listed.
Tyler C. Detomasi, et al.,
bioRxiv - Genetics 2022
Quote:
... 3 mM of chitooligosaccharides (DP 3-6) (Megazyme, Wicklow, Ireland) were treated with 0.12 mg/mL of ChitO (Gecco Biotech ...
-
No products found
because this supplier's products are not listed.
Daniel A. Kramer, et al.,
bioRxiv - Biochemistry 2023
Quote:
... All measurements were performed on a Horiba Scientific FluoroMax spectrofluorometer in 3 mm quartz cuvettes (Starna Cells, Inc. Cat # 3-3.45-Q-3). Normalized peak fluorescent values were calculated by dividing the fluorescence value of the peak by the concentration of that sample.
-
No products found
because this supplier's products are not listed.
Pavan Nayak, Arul Subramanian, Thomas Schilling,
bioRxiv - Developmental Biology 2022
Quote:
... using a BeadBug 3 Microtube Homogenizer D1030 (Benchmark Scientific), and RNA was extracted using Trizol according to the standard protocol (Invitrogen 15596018) ...
-
No products found
because this supplier's products are not listed.
Francisco Dominguez, et al.,
bioRxiv - Microbiology 2021
Quote:
... It was cloned into pE-SUMOpro-3 plasmid (LifeSensors Inc.) between Nco I and Xho I restriction sites ...
-
No products found
because this supplier's products are not listed.
Lisa Duvick, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 3-dimensional CT images were analyzed using Imaris 9.8 (Oxford Instruments). Kyphosis index was determined based on where the distance is calculated from a horizontal line drawn from the center of the C7 vertebrae to the center of the pelvis ...