-
No products found
because this supplier's products are not listed.
Daichi Yamasoba, et al.,
bioRxiv - Microbiology 2022
Quote:
... HEK293-ACE2 cells and HEK293-ACE2/TMPRSS2 cells were stained with rabbit anti-TMPRSS2 polyclonal antibody (BIOSS, Cat# BS-6285R, 1:100). Normal rabbit IgG (SouthernBiotech ...
-
No products found
because this supplier's products are not listed.
Bing Han, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
No products found
because this supplier's products are not listed.
Dennis J. Doorduijn, et al.,
bioRxiv - Microbiology 2021
Quote:
... for C5b6 with 1:500 dilution of goat-anti human C5 serum (Complement Technology) and for sMAC with 1 µg/ml biotinylated monoclonal anti-C7 (clone F10 ...
-
No products found
because this supplier's products are not listed.
Alice Lu-Culligan, et al.,
bioRxiv - Immunology 2021
Quote:
... were coated with 20 ng per well of human Syncytin-1 recombinant protein (Abnova #H00030816-Q01) in PBS and were incubated overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Redouane Aherrahrou, et al.,
bioRxiv - Genetics 2023
Quote:
... Human aortic SMCs (Cell Applications, Inc. ...
-
No products found
because this supplier's products are not listed.
Musleh M. Muthana, et al.,
bioRxiv - Immunology 2023
Quote:
... Azide-free human IgG-Fc was purchased from Athens Research and Technology (Athens ...
-
No products found
because this supplier's products are not listed.
Pehuén Pereyra Gerber, et al.,
bioRxiv - Microbiology 2021
Quote:
... incubated for 30 min with a PE-labeled anti–human IgG-Fc antibody (Leinco/Biotrend), washed again ...
-
No products found
because this supplier's products are not listed.
Lyra O. Randzavola, et al.,
bioRxiv - Immunology 2022
Quote:
... HEK293-F were transfected with polyethylenimine (Polyscience Europe GmbH) at a ratio of 1:3 DNA:polyethylenimine (Tom et al. ...
-
No products found
because this supplier's products are not listed.
Kang Wang, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... anti-human SLC7A11(Abclonal, #A13685, 1:1000), anti-human GPX4(Abcam ...
-
No products found
because this supplier's products are not listed.
Loyda M. Morales Rodríguez, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
HEK293 cells were plated onto 25mm coverslips (Electron Microscopy Sciences, #50949050) coated with poly-D-lysine (Sigma Aldrich ...
-
No products found
because this supplier's products are not listed.
Tamina Lebek, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... and resuspended in 10% FCS in PBS with either DAPI (1 μM; Biotium, #40043) or DRAQ7 (300 nM ...
-
No products found
because this supplier's products are not listed.
Cheyenne Hurst, et al.,
bioRxiv - Neuroscience 2022
Quote:
... recombinant human Aβ42 (5 μM) (rPeptide, # A-1170-1) was handled essentially as described (67 ...
-
No products found
because this supplier's products are not listed.
Takahiro Yamada, et al.,
bioRxiv - Microbiology 2019
Quote:
... 2 % FCS (MP Biomedicals, Santa Ana, CA), 100 U/mL penicillin ...
-
No products found
because this supplier's products are not listed.
David Beck, et al.,
bioRxiv - Genetics 2020
Quote:
... supplemented with 10% FCS (Gemini Bio-Products) and 1× antibiotics (Life Technologies) ...
-
No products found
because this supplier's products are not listed.
C. Maresca, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 50 units of purified human PARP-1 (High Specific Activity hPARP-1, Trevigen) were incubated in a mixture containing 100 mM Tris-HCl pH 8 ...
-
No products found
because this supplier's products are not listed.
Ashley A. Johnson, et al.,
bioRxiv - Physiology 2021
Quote:
... Spectra were measured from HEK293 cells using a 60x objective with NA 1.45 (Nikon) and an inverted microscope (Nikon TE-2000) ...
-
No products found
because this supplier's products are not listed.
Marisol Sampedro-Castañeda, et al.,
bioRxiv - Neuroscience 2023
Quote:
... mouse anti Cav α1E 1:1000 (Synaptic Systems, 152411, human neurons), rabbit anti CDKL5 1:2000 (Atlas ...
-
No products found
because this supplier's products are not listed.
Michael Tellier, et al.,
bioRxiv - Molecular Biology 2021
Quote:
RNA was extracted from HEK293 and CDK9as cells using a Quick-RNA Miniprep kit (Zymo Research) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Md. Alamgir Hossain, et al.,
bioRxiv - Immunology 2022
Quote:
... For that 2.5x105 cells were incubated with HIV-1 antigens in PBS/2% FCS for the indicated period of times on a 37°C thermomixer (Eppendorf). Cells were then fixed with IC fixation buffer on ice for 30 mins and at RT for additional 30 mins ...
-
No products found
because this supplier's products are not listed.
Anne-Claire Langlois, et al.,
bioRxiv - Microbiology 2020
Quote:
Human HDL lipoproteins (LP3, Calbiochem) were labeled using the Cy5 monoreactive Dye pack (PA25001 ...
-
No products found
because this supplier's products are not listed.
Erin A. Stephens, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... 50 μM human ubiquitin (Boston Biochem), 4 mM ATP and 1 mM DTT in 20 mM MOPs ...
-
No products found
because this supplier's products are not listed.
Damon A. Hofman, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... human EGF (20ng/mL; Shenandoah Biotech), human FGF-basic-154 (20ng/mL ...
-
No products found
because this supplier's products are not listed.
Bjoern Traenkle, et al.,
bioRxiv - Immunology 2021
Quote:
... an alpaca (Vicugna pacos) was immunized with the purified extracellular domains of human CD4 (aa26-390) recombinantly produced in HEK293 cells (antibodies-online GmbH, Germany). After initial priming with 1 mg ...
-
No products found
because this supplier's products are not listed.
Maali AlAhmad, et al.,
bioRxiv - Cell Biology 2024
Quote:
... HEK293-TRPM2tet cells grown in 96-well plates (Sarstedt) were preloaded with 1 µM Fura-2-AM/ 0.02% Pluronic® F127 (P-3000MP ...
-
No products found
because this supplier's products are not listed.
José A. González-Feliciano, et al.,
bioRxiv - Biochemistry 2020
Quote:
... The 2G12 and PG16 bNAbs in 0.5X Kinetics Buffer (PBS with 0.02% Tween and 0.05 mg/mL BSA) were loaded onto an anti-Human IgG Fc Capture sensor (Pall ForteBio Corp). Binding kinetics were determined using serial dilutions of CHO-K1-produced and Expi293F-produced gp145 ...
-
This tropoelastin is produced using recombinant production methods. The tropoelastin is supplied...
Cat# 5052-1MG,
1 mg, USD $375.0
Ask
Ines A Cadena, et al.,
bioRxiv - Bioengineering 2024
Quote:
... human (1 mg/mL, Advanced Biomatrix) and either GelMA (8.7% v/w ...
-
No products found
because this supplier's products are not listed.
Christian Franke, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Immunostaining of specific receptors was performed by incubating cells overnight with AlexaFluor 647 conjugated primary antibodies (human CD4: OKT4, dilution: 1:100, source: Biolegend; human CD45: MEM-28, dilution: 1:2000, source: ExBio) diluted in Blocking solution ...
-
No products found
because this supplier's products are not listed.
Alexandru-Ioan Voda, et al.,
bioRxiv - Genomics 2023
Quote:
... Human Anti-CD27 agonist antibody (100111-1, AMSBio) and Mouse Anti-CD6 agonist antibody (Clone UMCD6 ...
-
No products found
because this supplier's products are not listed.
Oktawia Nilsson, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and cholesterol (FC) (Avanti Polar Lipids) were dissolved in 3:1 chloroform:methanol ...
-
No products found
because this supplier's products are not listed.
Neha Upadhyay-Tiwari, et al.,
bioRxiv - Plant Biology 2024
Quote:
... with an autosampler (GILSON FC 203B). Buffer B was 200 mM ammonium formate with 90% (v/v ...
-
No products found
because this supplier's products are not listed.
Ling Ning Lam, et al.,
bioRxiv - Microbiology 2021
Quote:
... and inoculated at a ratio of 1:1000 into pooled human serum or pooled human urine (both purchased from Lee Biosolutions). At selected time points ...
-
No products found
because this supplier's products are not listed.
David Knupp, et al.,
bioRxiv - Genomics 2021
Quote:
... 100μg total RNA from cortex or cultured HEK293 cells was treated with or without 1μL of RNaseR [20 U/μl] (Lucigen), plus 1.9μL RNaseOUT [40 U/μL] (ThermoFisher Scientific ...
-
The original balance of enzymatic activities. Each lot assayed for collagenase, caseinase,...
Cat# LS004194,
100 mg, $42.00
Ask
Marco Bauzá-Thorbrügge, et al.,
bioRxiv - Physiology 2022
Quote:
Human adipocytes were isolated from adipose tissue samples by collagenase (type 1, Worthington, NJ, USA) as described previously [24] ...
-
No products found
because this supplier's products are not listed.
S. Jordan Kerns, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Human alveolar epithelial cells (Cell Biologics, Accegen) were cultured using SABM medium (Lonza ...
-
No products found
because this supplier's products are not listed.
Zintis Inde, et al.,
bioRxiv - Cell Biology 2020
Quote:
Human tissue microarrays were obtained from US Biomax, Inc ...
-
PRG-1 (EDTA -dPBS Solution) prepares the cells for PRG-2 (containing Trypsin) processing. Cell...
Cat# 4Z0-610,
100.0 mL, $68.0
Ask
Changsheng Chen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Human umbilical vein endothelial cells (HUVECs, Cell System) were cultured in endothelial cell growth medium according to the protocol provided by the manufacturer (VascuLife ...
-
No products found
because this supplier's products are not listed.
Emma T Crooks, et al.,
bioRxiv - Immunology 2021
Quote:
... followed by alkaline phosphatase labeled anti-human Fc conjugate (Accurate Chemicals) and were developed using SigmaFast BCIP/NBT (Sigma).
-
No products found
because this supplier's products are not listed.
Jiachen Huang, et al.,
bioRxiv - Immunology 2021
Quote:
... 25 µl of secondary antibody (goat anti-human IgG Fc; Meridian Life Science) at a 1:4,000 dilution in blocking buffer was applied to each well for 1 hr at room temperature ...
-
No products found
because this supplier's products are not listed.
Susanna R. Bidgood, et al.,
bioRxiv - Microbiology 2020
Quote:
... 1% FCS for 30 min and immune-stained with anti-GFP nanobody (Chromotek) conjugated in-house to AlexaFluor647-NHS (Invitrogen ...
-
Cat# HY-P70182-50 μg,
50 μg, USD $180.0
Ask
Huan Wang, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Teriparatide (Human parathyroid hormone-(1-34)) (MedChemExpress), Glu (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Sarah C. Rothschild, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... rabbit anti-human PROX1 (ReliaTech, 1:20), mouse anti-engrailed (Developmental Studies Hybridoma Bank ...
-
No products found
because this supplier's products are not listed.
Marcel Lagedroste, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Membranes were solubilized with 1% (w/v) of the lipid-like detergents FC-16 (Anatrace) for 1 h at 8°C ...
-
No products found
because this supplier's products are not listed.
Samuele Cancellieri, et al.,
bioRxiv - Genetics 2021
Quote:
... 100 ng ml-1 human thrombopoietin (TPO) (CellGenix, 1417-050) and 100 ng ml-1 recombinant human FMS-like Tyrosine Kinase 3 Ligand (Flt3-L ...
-
No products found
because this supplier's products are not listed.
Leslie E. Lupien, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... human DiI-VLDLs (1 mg protein/mL; Alfa Aesar Chemicals), LPL from bovine milk (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Suhas Sureshchandra, et al.,
bioRxiv - Immunology 2020
Quote:
... in RPMI supplemented with 1% Human AB Serum (Omega Scientific) for 7 days with media supplemented on day 3 ...
-
No products found
because this supplier's products are not listed.
Takafumi Kato, et al.,
bioRxiv - Molecular Biology 2021
Quote:
The sequence encoding the full-length human EAAT2 isoform 1 (SLC1A2; Uniprot ID P43004) was amplified from a human brain complementary DNA library (Zyagen) and inserted into the pEG BacMam vector54 ...
-
No products found
because this supplier's products are not listed.
Vasudha Tandon, et al.,
bioRxiv - Biochemistry 2021
Quote:
... total RNA from HEK293 cells were isolated using the NucleoSpin RNA kit (Macherey-Nagel, Bethlehem, PA). cDNA was synthesized using the iScript kit (Bio-Rad) ...
-
No products found
because this supplier's products are not listed.
Chung-Ling Lu, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Anti-human procollagen type 1 antibody (LF68, ENH018) was purchased from Kerafast Inc ...
-
No products found
because this supplier's products are not listed.
Eike K. Mahlandt, et al.,
bioRxiv - Cell Biology 2021
Quote:
... BOECs were stimulated with 1 U/ml human α-thrombin (HCT-0020, Haematologic technologies) diluted in phosphate-buffered saline.
-
No products found
because this supplier's products are not listed.
Niko Schwenzer, et al.,
bioRxiv - Cell Biology 2024
Quote:
HEK293 cells with constitutive expression of CaV subunits β3 and α2δ1 and inducible expression of α1D (Charles River Laboratories CT6232) were cultured in DMEM/F12 medium containing selection antibiotics and 0.6 µM isradipine (Sigma I6658) ...