-
No products found
because this supplier's products are not listed.
Myung Chung, et al.,
bioRxiv - Neuroscience 2024
Quote:
... HEK293-EGFP (GenTarget, Cat. No. #SC001), and NIH-3T3 (originally obtained from Riken Bioresource Research Center and gifted from Dr ...
-
No products found
because this supplier's products are not listed.
Yunqing Yu, et al.,
bioRxiv - Plant Biology 2024
Quote:
Parafilm (Bemis, IL, USA)
-
No products found
because this supplier's products are not listed.
Zhi Cheng, et al.,
bioRxiv - Biochemistry 2022
Quote:
... system was connected to a microtee connector (IDEX, IL). The microtee connector used 250 μm fused silica capillaries for both pathways ...
-
No products found
because this supplier's products are not listed.
Jean Farup, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and Collagen 3 (Cat nb GWB-7D650E, Genway Biotec Inc, CA, USA). After incubation in primary antibodies the membranes were incubated 1 hour with HRP-conjugated secondary antibodies ...
-
No products found
because this supplier's products are not listed.
Jennyfer M. Mitchell, Scott A. Nichols,
bioRxiv - Evolutionary Biology 2019
Quote:
... His-EmFAK and GST-EmITGB1 (Syd Labs) recombinant proteins ...
-
No products found
because this supplier's products are not listed.
Doris Krauter, et al.,
bioRxiv - Neuroscience 2021
Quote:
... using a diamond knife (Histo HI 4317, Diatome). Afterwards sections were stained according to Gallyas52 and with Methylene blue/ Azur II for 1 min ...
-
No products found
because this supplier's products are not listed.
Thomas D. Avery, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
NRF2/ARE luciferase reporter HEK293 cells (SL-0042-NP, Signosis, Santa Clara, USA) were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM ...
-
No products found
because this supplier's products are not listed.
Chunsheng Zhou, et al.,
bioRxiv - Immunology 2020
Quote:
... Recombinant IL-17F.S65L and IL-17F were synthesized by Bon Opus Biosciences (Millburn, NJ) by expression in Expi293 cells (ThermoFisher) ...
-
No products found
because this supplier's products are not listed.
Donald Iain MacDonald, et al.,
bioRxiv - Neuroscience 2023
Quote:
... we produced a mouse Tacr1 DNA construct by gene synthesis (Epoch Life Science, GS66243-3). Tacr1 was subcloned along with a synthesized human G-protein α-subunit gene Gα15 and GCaMP6s it into the lentiviral plasmid backbone pLV-CMV-PGK-Hyg (Cellomics Technology ...
-
No products found
because this supplier's products are not listed.
Jonathan Burnie, et al.,
bioRxiv - Microbiology 2021
Quote:
... Viruses were produced in HEK293 using Polyjet In Vitro Transfection Reagent (FroggaBio, Cat#SL100688). HEK293 cells were seeded at a density of 106 cells/mL in 6-well plates in complete media and were transfected with 3 µg of pDNA after cells had reached 70% confluence ...
-
No products found
because this supplier's products are not listed.
Andrea M. Chambers, et al.,
bioRxiv - Immunology 2021
Quote:
... 500 IU/mL IL-2 (Akron Biotech), 50 ng/mL hIL-21 (Gold Bio) ...
-
No products found
because this supplier's products are not listed.
Ozan S. Kumru, et al.,
bioRxiv - Immunology 2023
Quote:
... which was purchased from Pfanstiehl (Waukegan, IL).
-
No products found
because this supplier's products are not listed.
Aleksei Kuznetsov, et al.,
bioRxiv - Biochemistry 2020
Quote:
Human recombinant ACE2-His protein (Icosagen OÜ, Estonia, cat# P-302-100) and SARS-CoV-2 Spike protein S1 (Icosagen OÜ ...
-
No products found
because this supplier's products are not listed.
Victor Danelon, et al.,
bioRxiv - Neuroscience 2022
Quote:
Adult (2-3 months old) mouse brains were processed for Golgi staining as previously described (FD Rapid GolgiStain Kit, catalog #PK401, FD NeuroTechnologies) for 10d (Tran et al. ...
-
No products found
because this supplier's products are not listed.
Eva Jarc Jovičić, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 500 nM BHT and IS (8 pmol 18:3/18:3/18:3 triacylglycerol, 14:0/14:0 phosphatidylcholine, Larodan, Solna ...
-
No products found
because this supplier's products are not listed.
Ilana B. Kotliar, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (c1100) was from ProteoChem. N-hydroxysuccinimide was from Pierce (CAS:6066-82-6).
-
WB, ELISA
Cat# CDC-41,
0.1 mg, Inquire
Ask
Benoit Forget, et al.,
bioRxiv - Neuroscience 2021
Quote:
... pmirGLO-3’UTR_FosB and pmirGLO-3’UTR_Npas4 plasmids were purchased from Creative Biogene and the mimick-miR-1a-3p and mimick-miR-negative control from Qiagen (miScript miRNA Mimics) ...
-
No products found
because this supplier's products are not listed.
Tayler D. Sheahan, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 3 µM (Adooq Bioscience A18250); oxytocin ...
-
No products found
because this supplier's products are not listed.
Tomás Urzúa Lehuedé, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 3% Gelzan (PhytoTechnology laboratories, USA) plates and stored at 4°C for 3 days in the dark ...
-
No products found
because this supplier's products are not listed.
Shankar Thangamani, et al.,
bioRxiv - Microbiology 2021
Quote:
... ampicillin (69-52-3, IBI Scientific), and streptomycin (S6501 ...
-
No products found
because this supplier's products are not listed.
Sang-Chul Kim, et al.,
bioRxiv - Biochemistry 2022
Quote:
... polyclonal anti-CCA1 (R1234-3, Abiocode), and polyclonal anti-histone H3 (A01502 ...
-
No products found
because this supplier's products are not listed.
Mitchell R. Lewis, Tara L. Deans,
bioRxiv - Synthetic Biology 2023
Quote:
Mouse embryonic stem cells (harvested from a TARGATT mouse, Applied StemCell) (see Note 1).
-
No products found
because this supplier's products are not listed.
Itamar Harel, et al.,
bioRxiv - Neuroscience 2022
Quote:
... equipped with 3 emCCDs (Evolve, Photometrics Inc.) using an Olympus UPlanApo 100x (NA 1.40 ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Danielle M Paul, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Kinesore (3,5-dibromo-N′-[2,5-dimethyl-1-(3-nitrophenyl)-1H-pyrrol-3-yl]methylene}-4-hydroxybenzohydrazide) was obtained from Chembridge Corporation (Cat ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 8: (S)-2-Amino-6-((2-(3-methyl-3H-diazirin-3-yl)ethoxy)carbonylamino)hexanoic acid (PhK, Iris Biotech GmBH); and 9 ...
-
No products found
because this supplier's products are not listed.
Marc-Joseph Antonini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and Ag/AgCl electrode (BASi, 3 M NaCl) were used as the counter and reference electrodes ...
-
No products found
because this supplier's products are not listed.
Gabriele Ciceri, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... mouse anti-Nestin (M015012, Neuromics); mouse anti MAP2 (M1406 ...
-
No products found
because this supplier's products are not listed.
Jonathan D Teo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Six distinct fields of view per mouse were imaged at 15,000x magnification and captured as 3×3 tile scans using the JEOL integrated software and a high-sensitivity sCMOS camera (JEOL Matataki Flash). G-ratios were calculated as the diameter of the axon lumen divided by the diameter of the lumen plus myelin sheath (Song et al. ...
-
No products found
because this supplier's products are not listed.
Pauline Bohne, et al.,
bioRxiv - Neuroscience 2023
Quote:
... connected to the ‘Brain Infusion Kit 3’ (#0004760, Durect). Pumps were prepared sterilely according to the manual ...
-
No products found
because this supplier's products are not listed.
Hannah Wapenaar, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and HRP conjugated secondary antibody, PonceauS (3% trichloroacetic acid, 3% sulfosalicylic Acid, 0.2% Ponceau) or stainfree gels (Mini-PROTEAN TGX Stain-Free Precast Gels).
-
No products found
because this supplier's products are not listed.
Jean-Marc Aury, et al.,
bioRxiv - Genomics 2022
Quote:
... 3’-adenylated and Illumina adapters (Bioo Scientific, Austin, TX, USA) were then added using the Kapa Hyper Prep Kit (KapaBiosystems ...
-
No products found
because this supplier's products are not listed.
Luciana Galetto, et al.,
bioRxiv - Microbiology 2020
Quote:
... together with 3 μL of Sharpmass VI Prestained Protein Marker (EuroClone) and 5 μL of Unstained SDS-PAGE Standards ...
-
No products found
because this supplier's products are not listed.
Claudio A. Carril Pardo, et al.,
bioRxiv - Cell Biology 2021
Quote:
... anti-Urocortin 3 (rabbit, 1:300, Phoenix Pharmaceuticals H-019-29), anti-Pdx1 (guinea pig ...
-
No products found
because this supplier's products are not listed.
Ke-Ming Xie, et al.,
bioRxiv - Microbiology 2024
Quote:
... (3) Air Samples: BioSamplers KIT (225-9595, SKC, Eighty Four, PA) were installed at approximately 1.5 meters above floor at the ventilation points in the slaughter area ...
-
No products found
because this supplier's products are not listed.
Asad U. Malik, et al.,
bioRxiv - Biochemistry 2020
Quote:
... mouse monoclonal VPS35 (#SMC-605D, StressMarq Biosciences). Rabbit monoclonal anti-Total Rab35 (clone ID ...
-
No products found
because this supplier's products are not listed.
Pratiksha I. Thakore, et al.,
bioRxiv - Immunology 2022
Quote:
... Pertussis toxin (100ng/mouse, List Biological Laboratories) was injected intravenously on day 0 and day 2 post immunization ...
-
No products found
because this supplier's products are not listed.
William T. Molin, et al.,
bioRxiv - Genomics 2020
Quote:
... At the 2 leaf stage the seedlings were sprayed with glyphosate at 0.84 kg·ai·ha−1 using an air-pressurized indoor spray chamber (DeVries Manufacturing Co., Hollandale, MN) equipped with a nozzle mounted with 8002E flat-fan tip (Spraying Systems Co., Wheaton, IL) delivering 190 L·ha−1 at 220 kPa. ...
-
No products found
because this supplier's products are not listed.
Sultan Ahmed, Panashe Mabeza, Derek T Warren,
bioRxiv - Cell Biology 2019
Quote:
Human adult aortic VSMCs (passage 3-10) were purchased from Cell Applications Inc (Isolate-1) ...
-
No products found
because this supplier's products are not listed.
Surya Cayre, et al.,
bioRxiv - Developmental Biology 2020
Quote:
The following primary antibodies were used on mouse cell-derived lysates: anti-mouse milk proteins (Accurate Chemical; YNRMMSP; 1/2000), anti-mouse b-casein (a kind gift from C ...
-
No products found
because this supplier's products are not listed.
Vaibhav Sidarala, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Anti-mouse TFAM (1:1000; PhosphoSolutions 2001-TFAM), Tom20 (1:1000 ...
-
No products found
because this supplier's products are not listed.
M.M. Joglekar, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... VCAN (1:200, Mouse Anti-Versican Antibody 2B1, Seikagaku), and ELN (1:400 ...
-
No products found
because this supplier's products are not listed.
Robert N. Plasschaert, et al.,
bioRxiv - Neuroscience 2021
Quote:
RAW264.7 mouse macrophage cells (ATCC; confirmed by STR profiling, IDEXX) were transduced with increasing multiplicity of infections with LVV.GRN or LVV.GBA vector ...
-
No products found
because this supplier's products are not listed.
Zikou Liu, et al.,
bioRxiv - Molecular Biology 2021
Quote:
Mouse RIPK3 rabbit polyclonal PSC-2283-c100 (Axxora (Pro Sci))
-
No products found
because this supplier's products are not listed.
Dalia Rosano, et al.,
bioRxiv - Cancer Biology 2021
Quote:
CloneTracker XP 10M Barcode-3’ Library with RFP-Puro (BCXP10M3RP-P) was purchased from Cellecta. Production of lentiviral particles and MCF7 transduction was performed following CloneTracker™ XP Lentiviral Expressed Barcode Libraries online manual (https://manuals.cellecta.com/clonetracker-xp-lentiviral-barcode-libraries/) ...
-
No products found
because this supplier's products are not listed.
Elisa Maritan, et al.,
bioRxiv - Microbiology 2022
Quote:
... and sputter-coated with 3 nm of platinum (Q150T ES, Quorum Technologies Ltd, Ringmer, UK). Alternatively ...
-
No products found
because this supplier's products are not listed.
Yuko Ishida, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... rat anti-mouse F4/80 mAb (clone, BM8; BMA Biomedicals, Switzerland), rabbit anti-human CD3 pAbs ...
-
No products found
because this supplier's products are not listed.
Carla E. M. Golden, et al.,
bioRxiv - Neuroscience 2023
Quote:
... with the mouse/rat estradiol ELISA kit from Calbiotech (ES180S-100) after determining stage with the method described above in 18 rats (4 in proestrus > 5 hours before lights out ...
-
No products found
because this supplier's products are not listed.
Jean-Philippe Corre, et al.,
bioRxiv - Pathology 2022
Quote:
... platelets using DyLight488-anti-mouse GPIbβ antibody (0.1 μg, #X488, Emfret Analytics) and fibrin deposits using DyLight488-anti-human/mouse fibrin antibody (8 μg ...
-
No products found
because this supplier's products are not listed.
Lauren Kane, et al.,
bioRxiv - Genetics 2021
Quote:
... and Chroma #89014ET (3 colour) or #89000ET (4 colour) single excitation and emission filters (Chroma Technology Corp., Rockingham, VT) with the excitation and emission filters installed in Prior motorised filter wheels ...