-
No products found
because this supplier's products are not listed.
Luis Alfonso Yañez Guerra, Meet Zandawala,
bioRxiv - Evolutionary Biology 2023
Quote:
... HEK293-G5a (Angio-proteomie CAT no. cAP0200GFP-AEQ-Cyto) cells were cultured in 96 well-plates containing 100μl of DMEM (Thermo ...
-
No products found
because this supplier's products are not listed.
Larissa Kever, et al.,
bioRxiv - Microbiology 2021
Quote:
... coli Gyrase (HIS) Supercoiling Assay Kit (Inspiralis, Norwich, UK) using 1 U of the respective gyrases and the same Cg1978 concentrations as for the C.g ...
-
No products found
because this supplier's products are not listed.
Carina C D Joe, et al.,
bioRxiv - Bioengineering 2021
Quote:
Residual host-cell protein (HCP) was quantified using the HEK293 HCP ELISA kit (Cygnus Technologies) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Julia A Alvarez, et al.,
bioRxiv - Microbiology 2024
Quote:
... 20% heat inactivated (HI) fetal bovine serum (FBS) (Omega Scientific), 1% penicillin-streptomycin (Life Technologies ...
-
No products found
because this supplier's products are not listed.
Rufeng Xu, et al.,
bioRxiv - Pathology 2021
Quote:
... [3-3H] glucose (3 μCi; Moravek, California, USA) was administered at t = −90 min ...
-
No products found
because this supplier's products are not listed.
Mateo I Sanchez, Alice Y Ting,
bioRxiv - Synthetic Biology 2019
Quote:
... 0.54 g/L CSM –Ade – His –Leu –Lys –Trp –Ura (Sunrise Science Products)) ...
-
No products found
because this supplier's products are not listed.
Tyler C. Detomasi, et al.,
bioRxiv - Genetics 2022
Quote:
... 3 mM of chitooligosaccharides (DP 3-6) (Megazyme, Wicklow, Ireland) were treated with 0.12 mg/mL of ChitO (Gecco Biotech ...
-
No products found
because this supplier's products are not listed.
Venkatramana D. Krishna, et al.,
bioRxiv - Microbiology 2023
Quote:
... Brains were embedded in Tissue-Tek OCT (Andwin Scientific, IL) on dry ice ...
-
No products found
because this supplier's products are not listed.
Shanshan Lang, et al.,
bioRxiv - Bioengineering 2019
Quote:
... The recombinant extracellular domain of CD38 and PD-L1 was produced as a 6-His and AviTag™ fusion in HEK293 cells and purified by Ni-NTA followed by in vitro biotinylation by BirA biotin ligase (Avidity).
-
No products found
because this supplier's products are not listed.
Kari Martyniak, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 5.832g, Oakwood Chemical) were added to the solution under stirring to activate 30 % of the carboxylic acids of the oxidized alginate ...
-
No products found
because this supplier's products are not listed.
Elena Arutyunova, et al.,
bioRxiv - Biophysics 2021
Quote:
... The fusion protein was subsequently digested with His-tagged SUMO protease (McLab, South San Francisco, CA) at 4 °C for 1–2 h to remove the SUMO tag and the resulting cleavage mixture was then passed through Ni-NTA resin column ...
-
No products found
because this supplier's products are not listed.
Mohd Farid Abdul Halim, et al.,
bioRxiv - Microbiology 2023
Quote:
... maripaludis MM1265 or Δfdh1 Δfdh2 expressing fdh2-His were grown in 1-liter anaerobic Schott bottles (Chemglass) containing McCas-formate medium with a N2:CO2 (80:20 ...
-
No products found
because this supplier's products are not listed.
Lily R. Zehfus, et al.,
bioRxiv - Plant Biology 2021
Quote:
... Quercetin-3-O-glucoside and isorhamnetin-3-O-glucoside were obtained from Indofine Chemical Company ...
-
No products found
because this supplier's products are not listed.
Sabrina X. Van Ravenstein, et al.,
bioRxiv - Biochemistry 2022
Quote:
... TOP2β (Topogen, Cat# tg2010-3).
-
No products found
because this supplier's products are not listed.
Eric L. Van Nostrand, et al.,
bioRxiv - Genomics 2020
Quote:
... 3% Trichloroacetic acid (Glen Research) as the deblocking solution ...
-
No products found
because this supplier's products are not listed.
Xiong Liu, et al.,
bioRxiv - Physiology 2022
Quote:
... DTT was purchased from Thermo Fisher Scientific (Ottawa, ON, Canada) and disuccinimidyl tartrate (DST) from CovaChem (Loves Park, IL).
-
No products found
because this supplier's products are not listed.
Matiss Maleckis, et al.,
bioRxiv - Bioengineering 2024
Quote:
... and 10 μM Hexakis (2, 2, 3, 3-tetrafluoropropoxy) phosphazene (Apollo Scientific Ltd., Cheshire, UK) as lock masses ...
-
No products found
because this supplier's products are not listed.
James Peak, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and Fluorogold (FG; 3% in saline; Fluorochrome) into the GPe and SNr ...
-
No products found
because this supplier's products are not listed.
Yuma Kato, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and 3 μM CHIR99021 (Focus Biomolecules, USA). On day 2 ...
-
No products found
because this supplier's products are not listed.
Shahrnaz Kemal, et al.,
bioRxiv - Neuroscience 2023
Quote:
... All vectors contain an N-terminal 6x-His-tag, C terminal Strep-Tag II tag, with or without a N or C terminal fluorophore (EGFP, mNeonGreen (Allele Biotech), or mRuby2).
-
No products found
because this supplier's products are not listed.
Minh Dao Ngo, et al.,
bioRxiv - Immunology 2022
Quote:
... 3 mL aminopropyl SPE columns (Biotage; Charlotte, NC). The samples were dissolved in 1 ml of hexane and transferred to the SPE column ...
-
No products found
because this supplier's products are not listed.
Jolet Y. Mimpen, et al.,
bioRxiv - Immunology 2021
Quote:
... Primers (Supplementary Table 3) were purchased from Primerdesign Ltd (Primerdesign Ltd ...
-
No products found
because this supplier's products are not listed.
Rachel Grazda, et al.,
bioRxiv - Immunology 2023
Quote:
200μL fluorescent Dil (DilC18(3))-labeled liposomes (Liposoma) were administered to mice via retro-orbital I.V ...
-
No products found
because this supplier's products are not listed.
Cassidy M.R. Blackburn, et al.,
bioRxiv - Immunology 2020
Quote:
... media was removed and replaced with either D-10 (untreated) or D-10 + 50μg/ml oxidized LDL (hi oxLDL Kalen biomedical 770252-60) for 2 hours ...
-
No products found
because this supplier's products are not listed.
Ugo Dionne, et al.,
bioRxiv - Systems Biology 2020
Quote:
... prey strains are each expressing a gene of interest fused at its 3’ end to the DHFR F[3] and are resistant to hygromycin B (HPH 250 μg/ml, Bioshop Canada). The same BY4741 strains were used in the growth assays with the addition of knockout (KO ...
-
No products found
because this supplier's products are not listed.
Nadya Povysheva, Huiyuan Zheng, Linda Rinaman,
bioRxiv - Neuroscience 2021
Quote:
... adult male Sprague-Dawley rats (n=3; 225-250 g BW) were anesthetized by isoflurane inhalation (1-3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device in the flat skull position ...
-
Magnetofection
diificult to transfect cells
Cat# KM30350,
SilenceMag 200µL + CombiMag 100µL, USD $186.00/KIT
Ask
Viktória Szentgyörgyi, et al.,
bioRxiv - Immunology 2024
Quote:
... cells were transfected with 6 μg of the plasmids (3-3 μg for both targeted exon of LRBA) with Helix IN transfection reagent (OZ Biosciences). For control cells control vectors without gRNA insert were transfected ...
-
No products found
because this supplier's products are not listed.
Takiyah A. Ball, et al.,
bioRxiv - Microbiology 2019
Quote:
... Drag swabs (3” × 3” sterile gauze pads) in sterile skim milk was the preferred collection tool (Hardy Diagnostics, Inc., Santa Maria, CA). A sampling schematic was pre-drawn to ensure maximum sampling of the house floor environment ...
-
No products found
because this supplier's products are not listed.
Jaqueline S. Generoso, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rabbit polyclonal anti-capsule serotype 3 antiserum (SSI Diagnostica) followed by Alexa Fluor 594 goat anti-rabbit (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Deanna M. Marchionini, et al.,
bioRxiv - Neuroscience 2022
Quote:
... blocked in 10% normal goat serum/ 10% mouse- on-mouse blocking (ScyTek Laborities, No. MTM015)/ TBS ...
-
No products found
because this supplier's products are not listed.
Jasmine Alexander-Floyd, et al.,
bioRxiv - Immunology 2021
Quote:
... supernatants and recombinant cytokine standards were applied to anti-IL-1β antibody-coated (eBioscience) Immulon ELISA plates (ImmunoChemistry Technologies). IL-1β was detected using biotinylated anti IL-1β (eBioscience ...
-
No products found
because this supplier's products are not listed.
Cameron Vergato, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... anti-mouse IFNAR-1 antibody or mouse IgG (cat. #MS-GF-ED, Molecular Innovations, Novi, MI) diluted in sterile PBS and injected i.p ...
-
No products found
because this supplier's products are not listed.
James T. McKenna, et al.,
bioRxiv - Neuroscience 2020
Quote:
Mice were deeply anesthetized with isoflurane (1-3%) and viral injections were performed using a 1 µl Hamilton syringe (Cat#7001KH, Point Style 3, Hamilton Company, Reno, NV, USA), targeting BF (AP +0.14 mm ...
-
No products found
because this supplier's products are not listed.
Sonia Ponzo, et al.,
bioRxiv - Neuroscience 2019
Quote:
... We performed separate 3 (GVS: LGVS vs. RGVS vs. Sham) × 2 (Velocity ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Sara C. Di Rienzi, et al.,
bioRxiv - Microbiology 2022
Quote:
... 3-inch needle (N163D, Air-Tite Vet Premium Hypodermic Needles, USA) positioned at the level within the glass reactor such that the media level was at 15 mls ...
-
No products found
because this supplier's products are not listed.
Kiyohiko Andoh, Asami Nishimori, Yuichi Matsuura,
bioRxiv - Microbiology 2023
Quote:
... mouse anti-BLV p24 MAb (VMRD: BLV3), mouse anti-His tag MAb (MBL ...
-
No products found
because this supplier's products are not listed.
Nicholas F. Page, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Serum was diluted with PBS/0.2%BSA to fall into the linear range of a primate-specific IL-6 ELISA assay (Cell Sciences, Canton, MA), and the assay was performed according to the manufacturer’s instructions (see ref 25) ...
-
No products found
because this supplier's products are not listed.
Hanyuan Shen, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
A431 cells were treated with different injections for 48 hours in 96-well plates and the cell culture supernatant was collected and tested for the level of IL-1β by ELISA using human interleukin-1 beta ELISA kit (Biosensis, CA, USA) according to the kit protocol ...
-
No products found
because this supplier's products are not listed.
Marina Boudigou, et al.,
bioRxiv - Immunology 2021
Quote:
Total RNA from ex vivo sorted B cells (NA, SM and DN) and after culture (Primed, IFN-α and IL-21) was extracted using RNA isolation kits (Norgen Biotek) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Ningke Hou, et al.,
bioRxiv - Microbiology 2019
Quote:
... SSP4 (3’,6’-Di(O-thiosalicyl)fluorecein) was purchased from DOJINDO MOLECULAR TECHNOLOGIES (Bibli et al ...
-
No products found
because this supplier's products are not listed.
JM Sweeter, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Mouse AECs were stained for Muc5b by mouse monoclonal antibody 3AE (27) and rabbit antibody Scgb1a1 (Seven Hills BioReagents WRAB-3950).
-
No products found
because this supplier's products are not listed.
M. Martinez, et al.,
bioRxiv - Microbiology 2023
Quote:
... at 4°C and loaded 3 times in a CellD disrupter (Constant Systems). The lysate was centrifuged for 15min at 12000 x g at 4°C to remove cell debris and the supernatant was centrifuged again for 1h at 100000 x g at 4°C ...
-
No products found
because this supplier's products are not listed.
Sanket S. Ponia, et al.,
bioRxiv - Microbiology 2021
Quote:
... mouse anti ZIKV Envelope (#BF-1176-56, BioFront Technologies) and chicken antibody to SENV (#ab33988 ...
-
No products found
because this supplier's products are not listed.
Rupa Banerjee, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 6-9 PE-units) and 3-5 mg Silane-PEG-Biotin (Nanocs, 3400 Da) in a solution of 50 mL toluene at 55 °C ...
-
No products found
because this supplier's products are not listed.
Elke M. Muntjewerff, et al.,
bioRxiv - Physiology 2021
Quote:
... Mouse EIA kits from CUSABIO (CUSABIO Technology LLC, Houston, TX) were used to determine CgA (CSB-EL005344MO) ...
-
No products found
because this supplier's products are not listed.
Cameron L. Woodard, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Pipettes (3-5Ω) were pulled from borosilicate glass capillaries using a micropipette puller (Narishige International). The intracellular solution was cesium-based and contained the following in mM ...
-
No products found
because this supplier's products are not listed.
Timothy N. Hoang, et al.,
bioRxiv - Immunology 2020
Quote:
... and Mouse Polink-2 HRP (GBI Labs; Cat. No. D37-110 for Mx1). Slides were developed using Impact™ DAB (3,3′-diaminobenzidine ...
-
No products found
because this supplier's products are not listed.
Edward B. Irvine, et al.,
bioRxiv - Immunology 2021
Quote:
... Mouse anti-monkey IgM (clone 2C11-1-5) was acquired from Life Diagnostics. Soluble rhesus macaque FcγR2A and FcγR3A were acquired from the Duke Human Vaccine Institute Protein Production Facility.
-
No products found
because this supplier's products are not listed.
Yuki Sato, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... The embryos were embedded in 3% agarose/PBS and subjected to vibratome sectioning into 140-μm-thick sections at 5100 mz (Campden Instruments). The slices were pre-blocked with 5% fetal bovine serum (FBS ...