-
No products found
because this supplier's products are not listed.
Satoshi Imanishi, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... and the corresponding His tag (R06-32BH) were obtained from SignalChem Lifesciences (Richmond ...
-
No products found
because this supplier's products are not listed.
Alvina I. Khamidullina, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Primers CDKN1B-forv 5’-attagctagcATGTCAAACGTGCGAGTGTCTAA-3’ and CDKN1B-rev 5’-taatggatccTTACGTTTGACGTCTTCTGAGGC-3’ (Evrogen, Moscow, Russia) containing NheI and BamHI restriction sites were used for amplification ...
-
No products found
because this supplier's products are not listed.
Astrid Kollewe, et al.,
bioRxiv - Biochemistry 2021
Quote:
... manually packed 11 cm (AP-MS) or 23 cm (csBN-MS) with ReproSil-Pur 120 ODS-3 (C18; particle size 3 µm; Dr. Maisch HPLC, Germany) and electrosprayed (2.3 kV ...
-
No products found
because this supplier's products are not listed.
Patrick T Griffin, et al.,
bioRxiv - Genomics 2022
Quote:
... Custom mouse diets were formulated at Research Diets (New Brunswick, NJ ...
-
No products found
because this supplier's products are not listed.
Justine Creff, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 200 µg for HEK293) were incubated with 3 µg of the indicated antibodies and 12 µL protein sepharose beads (IPA300, Repligen) at 4°C for 4 h ...
-
This membrane protein is Mouse IL-17F / IL-24 (29-161). It has been tested in SDS-PAGE, SPR. We...
Cat# MP0268F,
1.0 case, Inquiry
Ask
Sumit Sen Santara, et al.,
bioRxiv - Immunology 2021
Quote:
... Siglec6-His tag (Creative Biolabs), 4μ8C ...
-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... A Mouse Relaxin-3 ELISA Kit was purchased from Signalway Antibody LLC (MD ...
-
No products found
because this supplier's products are not listed.
Alexander B. Coley, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Human embryonic kidney (HEK293) cell line was obtained from GenLantis (San Diego, CA) and cultured in MEM (Mediatech ...
-
No products found
because this supplier's products are not listed.
Anil Verma, et al.,
bioRxiv - Immunology 2023
Quote:
... were labeled with biotinylated anti-His tag monoclonal antibody (ThermoScientific) and used to capture His-tagged clade C gp120 Du151 protein (Immune Technologies). The gp120-expressing beads were then incubated with triplicate 5-fold dilutions of heat-inactivated serum samples in V-bottom plates for 1h at 37°C ...
-
No products found
because this supplier's products are not listed.
Saejeong Park, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... HEK293 cells were washed with PBS and lysed in NP-40 lysis buffer (Boston Bioproducts) including protease and phosphatase inhibitor (Roche) ...
-
No products found
because this supplier's products are not listed.
Huang Zhu, Dan S. Kaufman,
bioRxiv - Immunology 2019
Quote:
... 15 % heat-inactivated human AB serum (Valley Biomedical, Catalog # HP1022 HI),1 % P/S ...
-
No products found
because this supplier's products are not listed.
Laith H Harb, et al.,
bioRxiv - Immunology 2021
Quote:
... dust-free bedding (Shepherd Specialty Papers, Chicago, IL, USA). Animals were housed under a 12-hour day/night cycle ...
-
No products found
because this supplier's products are not listed.
Evelína Šťastná, et al.,
bioRxiv - Immunology 2023
Quote:
... and IL-17A standard (clone RP0128S-005, Kingfisher Biotech) was prepared following manufacturer’s instructions and used for making a log-transformed standard curve ...
-
No products found
because this supplier's products are not listed.
Dennis J Doorduijn, et al.,
bioRxiv - Immunology 2019
Quote:
... Nunc Maxisorp ELISA plates were coated overnight at 4 °C with 50 µl/well of 3 µg/ml monoclonal mouse IgG1 anti human C6 (Quidel) in PBS ...
-
No products found
because this supplier's products are not listed.
Kyung Ku Jang, et al.,
bioRxiv - Cell Biology 2022
Quote:
... The permeabilized organoids were washed 3 times with PBS and incubated with mouse anti-SARS-CoV-2 N antibody (1:1,000, ProSci, 10-605) and rabbit anti-ACE2 antibody (1:500 ...
-
No products found
because this supplier's products are not listed.
Naomi R. Shvedov, et al.,
bioRxiv - Neuroscience 2023
Quote:
... a 3 mm diameter round coverglass (3 mm circular, #1, Thomas Scientific), bonded to a stainless steel cannula (304 S/S Tubing .125” OD x .115” ID x 0.019” ...
-
No products found
because this supplier's products are not listed.
Qi Qu, et al.,
bioRxiv - Physiology 2023
Quote:
... TAG(16:0)3-d5 and TAG(18:0)3-d5 (CDN isotopes), while DAGs d5-DAG17:0/17:0 and d5-DAG18:1/18:1 (Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Daniel A. Kramer, et al.,
bioRxiv - Biochemistry 2023
Quote:
... All measurements were performed on a Horiba Scientific FluoroMax spectrofluorometer in 3 mm quartz cuvettes (Starna Cells, Inc. Cat # 3-3.45-Q-3). Normalized peak fluorescent values were calculated by dividing the fluorescence value of the peak by the concentration of that sample.
-
No products found
because this supplier's products are not listed.
Mingu Kang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... peroxiredoxin-3 (LF-PA0255, Abfrontier), phospho-PKA substrates (9624 ...
-
No products found
because this supplier's products are not listed.
Lior Tal, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Arabidopsis KAI2 protein was expressed as a 6× His-SUMO fusion protein using the expression vector pSUMO (LifeSensors). His-SUMO-KAI2 was isolated from by Ni-NTA resin and the eluted His-SUMO KAI2 was further separated by anion-exchange ...
-
No products found
because this supplier's products are not listed.
Mingqi Zhou, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 3 U APEX Taq (Genesee Scientific), and molecular-grade H2O to bring the total volume to 35 μl.
-
3',3'-Cyclic GAMP ( cGAMP ) ELISA / Assay Kit
Cat# K073-H1,
1.0 ea, USD $465.0
Ask
Abraham Shim, et al.,
bioRxiv - Genetics 2024
Quote:
... 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays #K067-H5) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Nobunao Ikewaki, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... 3’-diaminobenzidine/H2O2 solution (Nichirei Bioscience Inc., Japan). The primary antibody used was monoclonal antibody to mouse macrophages (BMA Biomedicals ...
-
No products found
because this supplier's products are not listed.
Greg Tram, et al.,
bioRxiv - Microbiology 2019
Quote:
... 3 µm particle size (Tosoh Biosciences, Tokyo, Japan). Samples were resuspended in buffer B (90% MeCN / 0.1% TFA ...
-
No products found
because this supplier's products are not listed.
Roya Yousefi, et al.,
bioRxiv - Biochemistry 2020
Quote:
... ANK-G (mouse, Antibodies incorporated), SYP (guinea pig ...
-
No products found
because this supplier's products are not listed.
Li Zhenyu, Li Tian, Liu Meisui, Ivanovic Tijana,
bioRxiv - Microbiology 2022
Quote:
... sn-(1-oleoyl-2-hydroxy)-glycerol-3-phospho-sn-3′-(1′-oleoyl-2’-hydroxy)-glycerol (ammonium salt) (18:1 BMP (R,R); Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Linlin You, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... coli TTC-pause at 13 mg/mL was incubated with 3-([3-cholamidopropyl] dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, 8 mM, final concentration; Hampton Research Inc.) prior to grid preparation ...
-
No products found
because this supplier's products are not listed.
Barun Mahata, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Next each of 3 100ul aliquots (∼1/3 of each 24 well) of cells were processed for H3K4me3 antibody (Epicypher, #13-0041), H3K27ac antibody (Epicypher ...
-
No products found
because this supplier's products are not listed.
Pavan Nayak, Arul Subramanian, Thomas Schilling,
bioRxiv - Developmental Biology 2022
Quote:
... using a BeadBug 3 Microtube Homogenizer D1030 (Benchmark Scientific), and RNA was extracted using Trizol according to the standard protocol (Invitrogen 15596018) ...
-
No products found
because this supplier's products are not listed.
Sarah A Fahlberg, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... and 3 μg/mL anti-myc IgY (Aves Labs) conjugated with Alexa488 using NHS chemistry ...
-
Cat# F3,
USD $18.00/EA
Ask
Richard J. Roller, et al.,
bioRxiv - Microbiology 2021
Quote:
... or mouse anti-VP5 (Biodesign. International) 1:500 ...
-
No products found
because this supplier's products are not listed.
Aya M. Saleh, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 5 mM tris(3-hydroxypropyltriazolylmethyl)amine (THPTA; Click Chemistry Tools), 2 mM copper sulfate ...
-
No products found
because this supplier's products are not listed.
Carlos A. Sánchez-León, et al.,
bioRxiv - Neuroscience 2020
Quote:
... a polyethylene tubing (3 mm inner diameter; A-M Systems), which acted as the active electrode for tRNS ...
-
No products found
because this supplier's products are not listed.
Joshua Hutchings, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 3 μL of BSA-blocked 5 nm gold nanoparticles (BBI Solutions) were added to a 30 μL GUV BR and gently agitated just prior to vitrification ...
-
No products found
because this supplier's products are not listed.
Celia Fernandez-Sanz, et al.,
bioRxiv - Physiology 2021
Quote:
... Nanogold particles were developed for 3 min using GoldEnhance™ (Nanoprobes). Gold enhancement was followed by fixation with 1.6% glutaraldehyde and 0.2% tannic acid in PBS ...
-
No products found
because this supplier's products are not listed.
Lisa Duvick, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 3-dimensional CT images were analyzed using Imaris 9.8 (Oxford Instruments). Kyphosis index was determined based on where the distance is calculated from a horizontal line drawn from the center of the C7 vertebrae to the center of the pelvis ...
-
No products found
because this supplier's products are not listed.
Matthias Schmidt, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... and 3-hydroxy-2,4-dimethylhexanoic acid were synthesized by Enamine (Ukraine).
-
No products found
because this supplier's products are not listed.
Xiaodan Zhang, et al.,
bioRxiv - Genomics 2021
Quote:
... anti-mouse Lyve1 antibody (1:100, AngioBio cat.no ...
-
No products found
because this supplier's products are not listed.
Rita R. Fagan, et al.,
bioRxiv - Neuroscience 2020
Quote:
... mouse anti-SERT (ST51-2; Mab Technologies), rabbit anti-HA (C29F4 ...
-
No products found
because this supplier's products are not listed.
Qian Xue, et al.,
bioRxiv - Cell Biology 2022
Quote:
... mouse anti-mCherry (Encor Biotechnology, MCA-1C51), rabbit anti-pY118 Paxillin (Novus Biologicals ...
-
No products found
because this supplier's products are not listed.
Remi Bos, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Mouse monoclonal to Islet-1 (Biorbyt, #Orb95122)(1:200) ...
-
No products found
because this supplier's products are not listed.
Siyi Du, et al.,
bioRxiv - Bioengineering 2019
Quote:
... N-succinimidyliodoacetate (SIA), purchased from Pierce (Rockford, IL). Spectra/por® dialysis membrane (mol. wt. cut-off 50,000) was acquired from Spectrum Laboratories, Inc ...
-
No products found
because this supplier's products are not listed.
Takuma Uo, et al.,
bioRxiv - Cancer Biology 2024
Quote:
Uptake of 3H-3-O-methylglucose (American Radiolabeled Chemicals, St. Louis, MO) and 3H-2-deoxyglucose (Perkin Elmer ...
-
No products found
because this supplier's products are not listed.
Jasmin N. Beaver, et al.,
bioRxiv - Neuroscience 2023
Quote:
... all mouse cages contained Nestlets (Ancare, Bellmore, NY) and huts ...
-
No products found
because this supplier's products are not listed.
Felix Jonas, Gilad Yaakov, Naama Barkai,
bioRxiv - Genomics 2022
Quote:
... Cells were processed for 3 cycles in a Bullet Blender 24 (Next Advance) at level 8 for 1 min ...
-
No products found
because this supplier's products are not listed.
Hannah I. Ghasemi, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... iPSCs were then treated with 3 ml pre-warmed Accutase (Innovative Cell Technologies) and the vessel was then incubated at 37ºC for 5 min ...
-
No products found
because this supplier's products are not listed.
Oghenerukevwe Akpoghiran, et al.,
bioRxiv - Neuroscience 2023
Quote:
... We employed 100 µL of 1-Bromo-3-Chloropropane (Molecular Research Center, Inc.) to separate the phases ...
-
No products found
because this supplier's products are not listed.
Gokul Swaminathan, et al.,
bioRxiv - Immunology 2021
Quote:
... following the Mouse Anti-OVA IgG Antibody Assay Kit (Chondrex), or as previously described (76).
-
No products found
because this supplier's products are not listed.
Rebekka Medert, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Pools of 2 or 3 E4.5 blastocysts were lysed in 10 μl lysis buffer (DirectPCR buffer, Viagen, supplemented with 2.5 μg/ml Proteinase K ...