-
No products found
because this supplier's products are not listed.
Paula Rodrigues de Almeida, et al.,
bioRxiv - Microbiology 2019
Quote:
Monoclonal antibody against ZIKV Non-Structural 1 (NS1) protein (Arigo Biolaboratories, Taiwan, Republic of China) was diluted 1:1000 in (PBS ...
-
No products found
because this supplier's products are not listed.
Maryann P. Platt, et al.,
bioRxiv - Microbiology 2022
Quote:
... anti-Spn serotype 4 (#16747, Statens Serum Institut) and cleaved-caspase-3 (AF835SP ...
-
No products found
because this supplier's products are not listed.
Shiwei Liu, et al.,
bioRxiv - Genomics 2020
Quote:
... parasites were grown in vitro at 37°C in solutions of 3% hematocrit (serotype A positive human erythrocytes, Valley Biomedical, Winchester, VA) in RPMI 1640 (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Mary Y. Chang, et al.,
bioRxiv - Cell Biology 2024
Quote:
... coli serotype 0111:B4 was purchased from List Biological Laboratories (Campbell, CA). Ifn-b was from PBL Interferon Source (Piscataway ...
-
No products found
because this supplier's products are not listed.
Grant M. Zane, et al.,
bioRxiv - Microbiology 2022
Quote:
AAV4 (and AAV5) VLP preparations were validated using the serotype-specific monoclonal antibodies ADK4 (Progen, 610147) and ADK5b (Origene ...
-
No products found
because this supplier's products are not listed.
Angela Ma, et al.,
bioRxiv - Microbiology 2022
Quote:
... adenovirus (D3Ultra Respiratory Virus Screening & Identification kit, Quidel, San Diego, CA), and cytomegalovirus (D3 DFA Cytomegalovirus Immediate Early Antigen Identification kit ...
-
No products found
because this supplier's products are not listed.
Ilana B. Kotliar, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (c1100) was from ProteoChem. N-hydroxysuccinimide was from Pierce (CAS:6066-82-6).
-
No products found
because this supplier's products are not listed.
Naomi R. Shvedov, et al.,
bioRxiv - Neuroscience 2023
Quote:
... a 3 mm diameter round coverglass (3 mm circular, #1, Thomas Scientific), bonded to a stainless steel cannula (304 S/S Tubing .125” OD x .115” ID x 0.019” ...
-
No products found
because this supplier's products are not listed.
Yanhua Du, et al.,
bioRxiv - Epidemiology 2019
Quote:
The genomes of SFTS virus isolates were compiled using the SeqMan program in the LaserGene software package (DNAStar). The percentage similarities of nucleotide identity or amino acid identity were calculated using the ClustalX software[16] ...
-
No products found
because this supplier's products are not listed.
Mingu Kang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... peroxiredoxin-3 (LF-PA0255, Abfrontier), phospho-PKA substrates (9624 ...
-
No products found
because this supplier's products are not listed.
Shankar Thangamani, et al.,
bioRxiv - Microbiology 2021
Quote:
... ampicillin (69-52-3, IBI Scientific), and streptomycin (S6501 ...
-
No products found
because this supplier's products are not listed.
Sang-Chul Kim, et al.,
bioRxiv - Biochemistry 2022
Quote:
... polyclonal anti-CCA1 (R1234-3, Abiocode), and polyclonal anti-histone H3 (A01502 ...
-
No products found
because this supplier's products are not listed.
Tyler B. Waltz, et al.,
bioRxiv - Neuroscience 2023
Quote:
Recombinant rat protein p11 (S100A10 Recombinant Protein, Aviva Systems Biology, OPCD06771) was dissolved in distilled water to obtain a final concentration of 100ug/mL and stored at -80C for less than one month ...
-
3',3'-Cyclic GAMP ( cGAMP ) ELISA / Assay Kit
Cat# K073-H1,
1.0 ea, USD $465.0
Ask
Abraham Shim, et al.,
bioRxiv - Genetics 2024
Quote:
... 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays #K067-H5) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Marcus Buggert, et al.,
bioRxiv - Immunology 2020
Quote:
... bulk memory or virus-specific CD8+ T cells were sorted into cold fetal bovine serum and frozen in RNAzol (Molecular Research Center). TCRβ transcripts were amplified using a template-switch anchored RT-PCR ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Membranes were blocked in skim milk and incubated with anti-MASP-3 mAb 38:12-3 (Hycult Biotech, HM2216) for 1.5h at RT and HRP-conjugated rabbit anti-rat (Agilent ...
-
No products found
because this supplier's products are not listed.
Mehdi Zouiouich, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5’-AAC CGC AAT CAC ATC CAC GA-3’/5’-CAC CTC TGC CAT GAT CAC CG-3’) and the repair template (synthesized by ProteoGenix). The repair template was composed of two homology arms of 1000 bp flanking a puromycin resistance gene and mClover3 coding sequence separated by a P2A cleavage site ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Danya Abazari, et al.,
bioRxiv - Neuroscience 2022
Quote:
Protein palmitoylation assay was performed using CAPTUREome S-palmitoylated protein kit (Badrilla, Leeds, UK), as described by manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Philip Jean-Richard-dit-Bressel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The center of the right side-wall included a recess (5 x 3 x 15 cm) that housed a magazine dish (3 cm diameter) into which 45mg grain pellets (Bio-Serv, NJ, USA) were delivered ...
-
No products found
because this supplier's products are not listed.
Junichi Suzuki,
bioRxiv - Physiology 2020
Quote:
... Total protein concentrations were measured using PRO-MEASURE protein measurement solution (iNtRON Biotechnology Inc., Gyeonggi-do, Korea).
-
No products found
because this supplier's products are not listed.
Petra Kangas, et al.,
bioRxiv - Cell Biology 2022
Quote:
... For depletion of the most abundant proteins from CSF ProteoSpin Abundant Serum Protein depletion kit (Norgen Biotek) was used according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Li-Ying Yu, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Recombinant MANF protein (P-101-100, Icosagen) in PBS at 200 ng/ul was used as positive control ...
-
No products found
because this supplier's products are not listed.
Yilun Sun, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... AcquaStain protein gel Coomassie stain (Bulldog Bio); Silver Stain solutions (Bio-Rad).
-
No products found
because this supplier's products are not listed.
Joshua Hutchings, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 3 μL of BSA-blocked 5 nm gold nanoparticles (BBI Solutions) were added to a 30 μL GUV BR and gently agitated just prior to vitrification ...
-
No products found
because this supplier's products are not listed.
Jens O. Watzlawik, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Non-phosphorylated Ub protein (Boston Biochem, U-100H), free non-phosphorylated ...
-
No products found
because this supplier's products are not listed.
Reza Nouri, et al.,
bioRxiv - Bioengineering 2022
Quote:
... LwaCas13a proteins were purchased from MCLAB (cat# CAS13a-100). Cas13a and crRNA were mixed in 1×PBS to form the non-activated Cas13a/crRNA at room temperature for 20 min and stored at -80°C ...
-
No products found
because this supplier's products are not listed.
Deborah L. Gater, et al.,
bioRxiv - Biophysics 2022
Quote:
... Vitamin D binding protein (DBP) was purchased from Athens Research and Vitamin D Binding protein (VDR ...
-
No products found
because this supplier's products are not listed.
Anna Bludau, et al.,
bioRxiv - Neuroscience 2020
Quote:
... nuclear proteins were extracted using the EpiQuick Nuclear Extraction Kit (Epigentek) according to the manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Carina C D Joe, et al.,
bioRxiv - Bioengineering 2021
Quote:
Residual host-cell protein (HCP) was quantified using the HEK293 HCP ELISA kit (Cygnus Technologies) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Luis Alfonso Yañez Guerra, Meet Zandawala,
bioRxiv - Evolutionary Biology 2023
Quote:
... HEK293-G5a (Angio-proteomie CAT no. cAP0200GFP-AEQ-Cyto) cells were cultured in 96 well-plates containing 100μl of DMEM (Thermo ...
-
No products found
because this supplier's products are not listed.
Shivani Ahuja, et al.,
bioRxiv - Biochemistry 2020
Quote:
... the protein was mixed 2:3 with monoolein (Nu-Chek Prep) and then 70 nl of this material was deposited on a glass slide (Molecular Dimensions) ...
-
No products found
because this supplier's products are not listed.
Alicia C. Strtak, et al.,
bioRxiv - Microbiology 2019
Quote:
... Mammalian expression vectors were generated by inserting c-myc tag and mRuby3 red fluorescent protein upstream of full length NS1-2 and then subcloning this into the pTagRFP-N vector in place of TagRFP (Epoch Life Sciences, Missouri City, TX). This construct will be referred to as RFP-NS1-2 ...
-
No products found
because this supplier's products are not listed.
Shu Liu, et al.,
bioRxiv - Neuroscience 2022
Quote:
... goat anti- xenotropic MLV virus antibody ABIN457298 (1:1000, antibodies-online); mouse anti- MLV gag ab100970 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Youssouf Sereme, et al.,
bioRxiv - Microbiology 2020
Quote:
... A poliovirus serology-positive control serum (Poliomyelitis virus kit, GenWay, San Diego, California, USA) was also used as a control ...
-
No products found
because this supplier's products are not listed.
Meropi Aravantinou, et al.,
bioRxiv - Immunology 2020
Quote:
... Virus titer was determined in CEMx174 cells (ATCC, Manassass, VA) by p27 ELISA quantification (ZeptoMetrix, Buffalo, NY) and syncytia scoring after 14 days with the calculation method of Reed and Meunch ...
-
No products found
because this supplier's products are not listed.
Joshua D. Powell, et al.,
bioRxiv - Microbiology 2024
Quote:
... NJ) and were seronegative to IAV antibodies by a commercial ELISA kit (Swine Influenza Virus Ab Test, IDEXX) prior to the start of the study ...
-
No products found
because this supplier's products are not listed.
Ke-Ming Xie, et al.,
bioRxiv - Microbiology 2024
Quote:
Total nucleic acids were extracted using the HP Virus DNA/RNA Kit (R6873; Omega Bio-Tek, Norcross, USA), and carrier RNA was not used during the process to avoid potential interference with sequencing results ...
-
No products found
because this supplier's products are not listed.
Qi Qu, et al.,
bioRxiv - Physiology 2023
Quote:
... TAG(16:0)3-d5 and TAG(18:0)3-d5 (CDN isotopes), while DAGs d5-DAG17:0/17:0 and d5-DAG18:1/18:1 (Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Alena Aliashkevich, et al.,
bioRxiv - Microbiology 2020
Quote:
3 gr of seeds (e.g. Medicago sativa) were mashed and soaked in 10 mL of water overnight followed by centrifugation at 5,000 rpm to remove the particulate fraction ...
-
No products found
because this supplier's products are not listed.
Zijun Sun, Thomas C. Südhof,
bioRxiv - Neuroscience 2020
Quote:
... fetal bovine serum (ATLANTA Biological; final concentration = 2-3%) were added to the culture medium ...
-
No products found
because this supplier's products are not listed.
Iris E. Glykofridis, et al.,
bioRxiv - Genetics 2022
Quote:
... Ab #3 (1:1000 in BSA, HPA028760, Atlas antibodies) and Ab #4 (1:1000 in BSA ...
-
No products found
because this supplier's products are not listed.
Rebekka Karlowitz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... mouse anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (5G4cc, HyTest, Turku, Finland), mouse anti-Vinculin (#V9131-100UL ...
-
No products found
because this supplier's products are not listed.
Celia Fernandez-Sanz, et al.,
bioRxiv - Physiology 2021
Quote:
... Nanogold particles were developed for 3 min using GoldEnhance™ (Nanoprobes). Gold enhancement was followed by fixation with 1.6% glutaraldehyde and 0.2% tannic acid in PBS ...
-
No products found
because this supplier's products are not listed.
Jia Tian, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... chicken anti-type 3 adenylyl cyclase (1:5000; Encor Biotechnology; Cat# CPCA-ACIII), and rabbit anti-PCM1 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Pooja Gupta, et al.,
bioRxiv - Biochemistry 2021
Quote:
... An initial crystallization condition was identified I the Wizards Classic 3&4 crystallisation screen (Rigaku), well F2 (40% PEG400 ...
-
No products found
because this supplier's products are not listed.
Elisa Maritan, et al.,
bioRxiv - Microbiology 2022
Quote:
... and sputter-coated with 3 nm of platinum (Q150T ES, Quorum Technologies Ltd, Ringmer, UK). Alternatively ...
-
No products found
because this supplier's products are not listed.
Brenda Vasquez, et al.,
bioRxiv - Neuroscience 2022
Quote:
... For these experiments we used 3 hemizygous transgenic Ai162D mice (Ai162(TIT2L-GC6s-ICL-tTA2)-D ...
-
No products found
because this supplier's products are not listed.
Arthur Forer, Shotaro Otsuka,
bioRxiv - Cell Biology 2023
Quote:
Gold beads (15 nm) conjugated with Protein A (Cytodiagnostics, Burlington, Ontario, Canada) were absorbed on both sides of the sections as fiducial markers for tomography reconstruction ...
-
No products found
because this supplier's products are not listed.
Lauren Kane, et al.,
bioRxiv - Genetics 2021
Quote:
... and Chroma #89014ET (3 colour) or #89000ET (4 colour) single excitation and emission filters (Chroma Technology Corp., Rockingham, VT) with the excitation and emission filters installed in Prior motorised filter wheels ...