-
No products found
because this supplier's products are not listed.
Myung Chung, et al.,
bioRxiv - Neuroscience 2024
Quote:
... HEK293-EGFP (GenTarget, Cat. No. #SC001), and NIH-3T3 (originally obtained from Riken Bioresource Research Center and gifted from Dr ...
-
No products found
because this supplier's products are not listed.
Joydeb Sinha, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Harvested virus was 0.4μM filtered (Celltreat 229749) and concentrated by centrifugation using a 100kdA cut-off PES protein concentrator (Pierce 88533 ...
-
No products found
because this supplier's products are not listed.
Jonathan Burnie, et al.,
bioRxiv - Microbiology 2021
Quote:
... Viruses were produced in HEK293 using Polyjet In Vitro Transfection Reagent (FroggaBio, Cat#SL100688). HEK293 cells were seeded at a density of 106 cells/mL in 6-well plates in complete media and were transfected with 3 µg of pDNA after cells had reached 70% confluence ...
-
No products found
because this supplier's products are not listed.
Trevor J. Hancock, et al.,
bioRxiv - Immunology 2022
Quote:
... as well as TGEV (transmissible gastroenteritis virus) (VMRD, Pullman, WA, USA). Normal cat serum was purchased from Jackson ImmunoResearch (West Grove ...
-
No products found
because this supplier's products are not listed.
Jieqiong Qu, et al.,
bioRxiv - Microbiology 2023
Quote:
... CHIKV virus stock (5 × 108 TCID50/mL) and full human blood (Sanquin) was 1:2 mixed to make the infectious blood meal with a final virus titer of 1.7× 108 TCID50/ml ...
-
No products found
because this supplier's products are not listed.
Taeyong Kwon, et al.,
bioRxiv - Microbiology 2022
Quote:
... The same amount of the virus was mixed with 45 µL of human saliva (Lee Biosolutions) or medium and transferred into a 2 mL tube or onto stainless steel in the 12-well plate ...
-
No products found
because this supplier's products are not listed.
Tyler C. Detomasi, et al.,
bioRxiv - Genetics 2022
Quote:
... 3 mM of chitooligosaccharides (DP 3-6) (Megazyme, Wicklow, Ireland) were treated with 0.12 mg/mL of ChitO (Gecco Biotech ...
-
No products found
because this supplier's products are not listed.
Lijun Cong, et al.,
bioRxiv - Microbiology 2021
Quote:
... prior to cell supernatants being collected for quantification of virus production by HIV-1 p24 ELISA (XpressBio).
-
No products found
because this supplier's products are not listed.
Colin L. Hisey, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... a pooled digest (3 µg of protein from the fifteen 15 µg samples) was applied to an SCX MicroSpin column (The Nest Group, Inc.) according to manufacturer’s instructions and fractionated using 50 mM ...
-
No products found
because this supplier's products are not listed.
Eva Jarc Jovičić, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 500 nM BHT and IS (8 pmol 18:3/18:3/18:3 triacylglycerol, 14:0/14:0 phosphatidylcholine, Larodan, Solna ...
-
Superoxide dismutase (SOD) is an antioxidant enzyme involved in the defense system against...
Cat# PBCA1002,
Inquiry
Ask
Benoit Forget, et al.,
bioRxiv - Neuroscience 2021
Quote:
... pmirGLO-3’UTR_FosB and pmirGLO-3’UTR_Npas4 plasmids were purchased from Creative Biogene and the mimick-miR-1a-3p and mimick-miR-negative control from Qiagen (miScript miRNA Mimics) ...
-
No products found
because this supplier's products are not listed.
Tayler D. Sheahan, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 3 µM (Adooq Bioscience A18250); oxytocin ...
-
No products found
because this supplier's products are not listed.
Tomás Urzúa Lehuedé, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 3% Gelzan (PhytoTechnology laboratories, USA) plates and stored at 4°C for 3 days in the dark ...
-
No products found
because this supplier's products are not listed.
Alberto Domingo López-Muñoz, et al.,
bioRxiv - Microbiology 2021
Quote:
... alone or in combination with purified recombinant proteins were placed in the lower chamber of a 96-well ChemoTx System plate (Neuro Probe # 101-3 and # 101-5) in RPMI 1640 1% FBS ...
-
No products found
because this supplier's products are not listed.
Avital Licht-Murava, et al.,
bioRxiv - Neuroscience 2022
Quote:
... per ml culture medium at DIV 8 using Lipofectamine 3000 5 h before infection with vesicular stomatitis virus (VSV) at 100 MOI or with adenovirus-eGFP (Ad5CMV-eGFP, lot #ad3586, Viral Vector Core Facility, Carver College of Medicine ...
-
No products found
because this supplier's products are not listed.
José Gustavo Ramírez-Paredez, et al.,
bioRxiv - Microbiology 2020
Quote:
Nucleic acids were used for the detection of tilapia lake virus and nodavirus by quantitative PCR using the commercial kits: Path-TiLV-EASY and Path-Betanodavirus-EASY (Primerdesign, Southampton, UK) in the platform Genesig q16® (Primerdesign ...
-
No products found
because this supplier's products are not listed.
Itamar Harel, et al.,
bioRxiv - Neuroscience 2022
Quote:
... equipped with 3 emCCDs (Evolve, Photometrics Inc.) using an Olympus UPlanApo 100x (NA 1.40 ...
-
No products found
because this supplier's products are not listed.
Danielle M Paul, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Kinesore (3,5-dibromo-N′-[2,5-dimethyl-1-(3-nitrophenyl)-1H-pyrrol-3-yl]methylene}-4-hydroxybenzohydrazide) was obtained from Chembridge Corporation (Cat ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 8: (S)-2-Amino-6-((2-(3-methyl-3H-diazirin-3-yl)ethoxy)carbonylamino)hexanoic acid (PhK, Iris Biotech GmBH); and 9 ...
-
No products found
because this supplier's products are not listed.
Minh Dao Ngo, et al.,
bioRxiv - Immunology 2022
Quote:
... 3 mL aminopropyl SPE columns (Biotage; Charlotte, NC). The samples were dissolved in 1 ml of hexane and transferred to the SPE column ...
-
No products found
because this supplier's products are not listed.
Marc-Joseph Antonini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and Ag/AgCl electrode (BASi, 3 M NaCl) were used as the counter and reference electrodes ...
-
No products found
because this supplier's products are not listed.
Stephen Meek, et al.,
bioRxiv - Immunology 2021
Quote:
... 25 ng/ml rpIL-3 (Kingfisher Biotech, #RP1298S). Attached EBs were fed every 4 days with Macrophage Induction medium ...
-
No products found
because this supplier's products are not listed.
Otto Kauko, et al.,
bioRxiv - Cancer Biology 2022
Quote:
Antibodies to Tcf4 (Clone 6H5-3 Exalpha Biologicals), β-catenin (Rabbit Polyclonal Antibody ...
-
No products found
because this supplier's products are not listed.
Fenghua Qian, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 10 ng/mL mrIL-3 (Gemini bio-products), and 10 ng/mL mrIL-6 (Gemini bio-products) ...
-
No products found
because this supplier's products are not listed.
Nadya Povysheva, Huiyuan Zheng, Linda Rinaman,
bioRxiv - Neuroscience 2021
Quote:
... adult male Sprague-Dawley rats (n=3; 225-250 g BW) were anesthetized by isoflurane inhalation (1-3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device in the flat skull position ...
-
Lenti/Retro Virus
Cat# LVB1000,
Conservation Buffer (1mL), USD $95.00/mL
Ask
Viktória Szentgyörgyi, et al.,
bioRxiv - Immunology 2024
Quote:
... cells were transfected with 6 μg of the plasmids (3-3 μg for both targeted exon of LRBA) with Helix IN transfection reagent (OZ Biosciences). For control cells control vectors without gRNA insert were transfected ...
-
No products found
because this supplier's products are not listed.
Helene Jahn, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Protein concentration was determined by SDS-PAGE (Coomassie or Fluorescence Protein gel stain (Lamda Biotech)) in comparison with standards ...
-
No products found
because this supplier's products are not listed.
Dong Hun Lee, et al.,
bioRxiv - Physiology 2022
Quote:
Human pulmonary artery endothelial cells HPAEC (3 × 105/well) derived from 3 separate individuals were cultured in 6 well plates with ECM media (ScienCell, Carlsbad, CA) then treated with TGF-β (10 ng/ml) ...
-
No products found
because this supplier's products are not listed.
Jonathan D Teo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Six distinct fields of view per mouse were imaged at 15,000x magnification and captured as 3×3 tile scans using the JEOL integrated software and a high-sensitivity sCMOS camera (JEOL Matataki Flash). G-ratios were calculated as the diameter of the axon lumen divided by the diameter of the lumen plus myelin sheath (Song et al. ...
-
No products found
because this supplier's products are not listed.
Thomas M. Winkelmüller, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 800 µl of 3 µM flg22 (EZBiolab Inc., USA) solution was added to the medium containing the seedlings resulting in a final concentration of 1 µM flg22 ...
-
No products found
because this supplier's products are not listed.
Chikako Kuwabara, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 3 ml/L Plant Preservative Mixture (Plant Cell Technology), and 3 g/L phytagel ...
-
No products found
because this supplier's products are not listed.
Pauline Bohne, et al.,
bioRxiv - Neuroscience 2023
Quote:
... connected to the ‘Brain Infusion Kit 3’ (#0004760, Durect). Pumps were prepared sterilely according to the manual ...
-
No products found
because this supplier's products are not listed.
Mohan Kumar Muthu Karuppan, et al.,
bioRxiv - Immunology 2019
Quote:
... Viral proteins were purchased from ImmunoDx, Woburn ...
-
No products found
because this supplier's products are not listed.
Jean-Marc Aury, et al.,
bioRxiv - Genomics 2022
Quote:
... 3’-adenylated and Illumina adapters (Bioo Scientific, Austin, TX, USA) were then added using the Kapa Hyper Prep Kit (KapaBiosystems ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Ke-Ming Xie, et al.,
bioRxiv - Microbiology 2024
Quote:
... (3) Air Samples: BioSamplers KIT (225-9595, SKC, Eighty Four, PA) were installed at approximately 1.5 meters above floor at the ventilation points in the slaughter area ...
-
No products found
because this supplier's products are not listed.
Daniel D. Lane, et al.,
bioRxiv - Bioengineering 2024
Quote:
... thrombopoetin (TPO) and Flt-3 ligand (both from CellGenix, Freiburg, Germany). An overnight pre-treatment incubation was carried out after thaw at 37 °C ...
-
No products found
because this supplier's products are not listed.
Qiyue Ding, et al.,
bioRxiv - Biochemistry 2020
Quote:
Protein thiol redox states were monitored using the -SulfoBiotics- Protein Redox State Monitoring Kit Plus (Catalog # SB12; Dojindo Molecular Technologies). Samples were labeled with the Protein-SHifter Plus in accordance with the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Matthew S. Yorek, et al.,
bioRxiv - Microbiology 2019
Quote:
... We obtained our recombinant proteins from Tonbo biosciences which included mouse CXCL1 ...
-
Dengue Virus NS1 Subtype 3 is a recombinant viral antigen from dengue virus.
Cat# abx260205-1MG,
1 mg USD $2073.5
Ask
Mohadeseh Hasanpourghadi, et al.,
bioRxiv - Immunology 2022
Quote:
Sera were tested for antibodies to the N protein by an ELISA on plates coated with 1 µg of a purified N protein (Abbexa, abx163973) using the same procedures as for antibodies to the S protein ...
-
No products found
because this supplier's products are not listed.
Sandro Roier, et al.,
bioRxiv - Immunology 2023
Quote:
... The protein vaccines were alum-adjuvanted by adsorption of the recombinant fusion proteins to aluminum hydroxide (Alhydrogel®; Croda, Frederikssund, Denmark) as previously described22 ...
-
No products found
because this supplier's products are not listed.
M. Martinez, et al.,
bioRxiv - Microbiology 2023
Quote:
... at 4°C and loaded 3 times in a CellD disrupter (Constant Systems). The lysate was centrifuged for 15min at 12000 x g at 4°C to remove cell debris and the supernatant was centrifuged again for 1h at 100000 x g at 4°C ...
-
No products found
because this supplier's products are not listed.
Chuan Xu, et al.,
bioRxiv - Immunology 2023
Quote:
Rabbit polyclonal antibodies against human or murine IFNε proteins were generated by using peptides derived from IFNε protein sequences (Lampire Biological Laboratories (Pipersville, PA). The specificity of antibodies was determined by western blot analysis ...
-
No products found
because this supplier's products are not listed.
Justin Judd, Jonathan Lovas, Guo N. Huang,
bioRxiv - Developmental Biology 2019
Quote:
... Proteins were then transferred to PVDF-Plus membranes (Spectrum Chemical) and blocked in 5% milk in TBST (0.1% Tween 20) ...
-
No products found
because this supplier's products are not listed.
Rupa Banerjee, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 6-9 PE-units) and 3-5 mg Silane-PEG-Biotin (Nanocs, 3400 Da) in a solution of 50 mL toluene at 55 °C ...
-
No products found
because this supplier's products are not listed.
Dalia Rosano, et al.,
bioRxiv - Cancer Biology 2021
Quote:
CloneTracker XP 10M Barcode-3’ Library with RFP-Puro (BCXP10M3RP-P) was purchased from Cellecta. Production of lentiviral particles and MCF7 transduction was performed following CloneTracker™ XP Lentiviral Expressed Barcode Libraries online manual (https://manuals.cellecta.com/clonetracker-xp-lentiviral-barcode-libraries/) ...
-
No products found
because this supplier's products are not listed.
Gab-Chol Choi, et al.,
bioRxiv - Bioengineering 2020
Quote:
... and bone morphogenetic protein 2 (BMP-2) (1:200, orb251474, Biorbyt) primary antibodies at 4°C ...
-
No products found
because this supplier's products are not listed.
Jeremy Ariey-Bonnet, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... The reagents (compound, protein, and fluorophore) were dispensed using an Echo550 acoustic dispenser (Labcyte): 100 nL of compound (from a 100% DMSO stock at 10 mM ...
-
No products found
because this supplier's products are not listed.
Brynna S. Eisele, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The volume of concentrated samples was adjusted to 70 ul and 3 ul of Chondroitinase ABC (1.4 U/ml Stock solution, containing BSA, Seikagaku) was added to each sample ...
-
No products found
because this supplier's products are not listed.
Sujatha Muralidharan, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... A normal tissue TMA consisting of different organ specimens from 3 unique individuals was sourced from US Biomax (Cat# FDA999w1).