-
No products found
because this supplier's products are not listed.
James P Bridges, et al.,
bioRxiv - Cell Biology 2021
Quote:
HEK293 cells were seeded in 384-well plates (Greiner, #781946) at 30 000 cells/well ...
-
No products found
because this supplier's products are not listed.
Kyoko Tossell, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Stereotaxic virus injections were performed using an Angle Two apparatus (Leica) linked to a digital brain atlas (Leica Biosystems Richmond ...
-
No products found
because this supplier's products are not listed.
Luisa Saecker, Hanns Häberlein, Sebastian Franken,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... [2-Amino-4-[3-(trifluoromethyl)phenyl]-3-thienyl] phenylmethanone (VCP 171; Tocris, 1018830-99-3), 5-[2-(5-nitro-2-furanyl)ethenyl]-2-furancarboxylic acid ...
-
No products found
Shuai Yan, et al.,
bioRxiv - Physiology 2023
Quote:
Adeno-associated virus serotype 8 expressing mouse Aig1 and AAV8-GFP control were purchased from Applied Biological Materials (Canada). AAV injection was carried out as previously described57 ...
-
No products found
because this supplier's products are not listed.
Max Paget, et al.,
bioRxiv - Immunology 2022
Quote:
... MDCK cells expressing IAV-NS1 (MDCK-NS1 cells) were infected with IAVdelNS1 in EMEM containing 0.35% bovine serum albumin (BSA, MP Biomedicals), 4 mM L-glutamine ...
-
No products found
because this supplier's products are not listed.
Gabriele Liuzzi, Antonello Mallamaci,
bioRxiv - Developmental Biology 2023
Quote:
- αMecP2 (rat polyclonal IgG2a serotype, Active Motif #61291), 3 μg/reaction.
-
No products found
because this supplier's products are not listed.
Andre Watson, et al.,
bioRxiv - Bioengineering 2020
Quote:
ACE2-HEK293s (BPS Bioscience) were cultured and transduced in opaque 96-well white plates (Corning® ...
-
No products found
because this supplier's products are not listed.
Katarzyna Bogucka-Janczi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Cdc42 and ARP3 proteins or ARP2/3 protein complex (Cytoskeleton) were used as bait and full-length GST-ERK3 (SignalChem ...
-
No products found
because this supplier's products are not listed.
Thomas Laval, et al.,
bioRxiv - Immunology 2021
Quote:
... coli serotype 055:B5 TLR grade was purchased from Enzo Life Sciences. Pam3Csk4 was obtained from Invivogen ...
-
No products found
because this supplier's products are not listed.
Xiaozhen Liu, et al.,
bioRxiv - Genetics 2022
Quote:
... and vesicular stomatitis virus G protein (VSV-G) plasmid using polyetherimide (PEI) (B600070, ProteinTech Group, Chicago, USA) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Andrew B Janowski, et al.,
bioRxiv - Microbiology 2022
Quote:
... the virus RNA was isolated from the virus stocks using Direct-zol RNA MicroPrep (Zymo research) and used for RT-PCR and Sanger sequencing of the entire virus genome.
-
No products found
because this supplier's products are not listed.
Ellen Van Gulck, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 48h post transfection virus was collected and concentrated with PEG Virus Precipitation Kit (BioVision Inc, USA) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Judit Vágó, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Equal amounts of protein (3 µg) were loaded into 12–230 kDa separation modules (Protein Simple, Bio-Techne ...
-
No products found
because this supplier's products are not listed.
Jingyi Guo Fuglstad, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Fluorescent signal from the virus was amplified by immunostaining against Red Fluorescent Protein (RFP) (catalog no.5F8, Chromotek GmbH, Germany), followed by secondary antibody-staining with Alexa 546-tagged Goat Anti-rat IgG (catalog no ...
-
No products found
because this supplier's products are not listed.
Iktae Kim, et al.,
bioRxiv - Biophysics 2022
Quote:
The binding of surface-immobilized NS1 to p85β was measured at 25 °C using an Octet RED biolayer interferometry (Pall ForteBio). The N-terminal His6 and SUMO-tagged NS1 proteins were used for immobilization ...
-
No products found
because this supplier's products are not listed.
Farès Ousalem, et al.,
bioRxiv - Microbiology 2023
Quote:
Protein samples were injected onto a Yarra 3 µm SEC-2000 (Phenomenex) running at room temperature in 150 mM NaCl ...
-
No products found
because this supplier's products are not listed.
Joshua J. Sims, et al.,
bioRxiv - Genetics 2021
Quote:
... We measured reporter virus transduction activity on a luminometer (BioTek) using the Renilla Glo Kit (Promega ...
-
No products found
because this supplier's products are not listed.
Ashley A. Johnson, et al.,
bioRxiv - Physiology 2021
Quote:
... Spectra were measured from HEK293 cells using a 60x objective with NA 1.45 (Nikon) and an inverted microscope (Nikon TE-2000) ...
-
Lower in secondary proteolytic contaminant activities but with typical collagenase activity. ...
Cat# LS004183,
5 gm, $900.00
Ask
Svenja Fritzlar, et al.,
bioRxiv - Microbiology 2023
Quote:
... virus was activated by adding 8μg/mL trypsin (TPCK treated, Worthington, Lakewood, NJ) in FCS-free media to samples in a 1:1 ratio ...
-
No products found
because this supplier's products are not listed.
Annie M Goettemoeller, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the membranes were washed 3 times and biotinylated proteins were detected on Odyssey Infrared Imaging System (LI-COR Biosciences). In parallel ...
-
No products found
because this supplier's products are not listed.
Yanyan Geng, et al.,
bioRxiv - Neuroscience 2022
Quote:
Whole cell recordings were obtained from HEK293 cells using an Axopatch 200B amplifier (Molecular Devices, San Jose, CA). Recordings were filtered at 5 kHz with the amplifier internal filter and digitized at 50 kHz using a Digidata 1550B digitizer (Molecular Devices ...
-
No products found
because this supplier's products are not listed.
Thomas R. Gawriluk, et al.,
bioRxiv - Immunology 2019
Quote:
... and given autoclaved water and a 3:1 mixture by volume of 14% protein mouse chow (Teklad Global 2014, Envigo) and black-oil sunflower seeds (Pennington Seed Inc. ...
-
No products found
because this supplier's products are not listed.
Ana Lima, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... and 3 μM GSK-3 inhibitor CHIR9902 (Cayman Chemicals) for 2 days at 37°C in 5% CO2 incubator ...
-
No products found
because this supplier's products are not listed.
Varun Tiwari, et al.,
bioRxiv - Biophysics 2020
Quote:
Purified GLIC protein was reconstituted into liposomes formed with 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (PE, Avanti Polar Lipids) and 1-palmitoyl-2-oleoyl-sn-glycero-3-phospho-(1’-rac-glycerol ...
-
No products found
because this supplier's products are not listed.
Romina Marone, et al.,
bioRxiv - Bioengineering 2023
Quote:
... containing 300 cells and with 10ng/ml IL-3 (+IL-3 treatment) or without IL-3 (-IL-3 treatment) were plated in a well of a SmartDish (StemCell Technologies, Seattle, WA, USA) in duplicates ...
-
No products found
because this supplier's products are not listed.
Casey L. Mahoney-Crane, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Sections were developed using ImmPACT-3 3’-diaminobenzidine (DAB; Vector Labs), sequentially dehydrated as previously described (Stoyka et al. ...
-
No products found
because this supplier's products are not listed.
Vidur Garg, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... + 3% donkey serum (Jackson ImmunoResearch)] at room temperature for 15 mins ...
-
No products found
because this supplier's products are not listed.
Justine Creff, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 200 µg for HEK293) were incubated with 3 µg of the indicated antibodies and 12 µL protein sepharose beads (IPA300, Repligen) at 4°C for 4 h ...
-
No products found
because this supplier's products are not listed.
Chenyan Ma, et al.,
bioRxiv - Neuroscience 2023
Quote:
... starting at day 3 post virus injection (250 mg tamoxifen per kg of chow, Research Diets). Mice were gavaged with two additional doses of tamoxifen (250 mg/kg body weight ...
-
No products found
J.A. McPhail, et al.,
bioRxiv - Biochemistry 2019
Quote:
... HEK293-AT1 cells (3×105 cells/well) were plated on 29 mm circular glass-bottom culture dishes (#1.5; Cellvis) pre-coated with 0.01% poly-L-lysine solution (Sigma) ...
-
No products found
because this supplier's products are not listed.
Felix Pahmeier, et al.,
bioRxiv - Microbiology 2020
Quote:
Huh7-Lunet-T7 cells expressing the dengue reporter constructs (Lunet-T7-RC) were seeded onto a glass bottom 35 cm2 dish (Mattek) at a density of 2 × 104 ...
-
No products found
because this supplier's products are not listed.
Nitin T. Supekar, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Data analysis was performed using Byonic 2.3 software and manually using Xcalibur 4.2 and GlycoWorkbench 1.1. The N protein expressed in HEK293 cells (Cat. No. NUN-C5227) was purchased from AcroBiosystems (Newark, DE).
-
No products found
because this supplier's products are not listed.
Masaya Yamaguchi, et al.,
bioRxiv - Microbiology 2019
Quote:
Human TLR2/NF-κB/SEAP stably transfected HEK293 cells and human TLR4/MD-2/CD14/NF-κB/SEAP stably transfected HEK293 cells (Novus Biologicals, Centennial ...
-
No products found
because this supplier's products are not listed.
Filippo Bianchini, et al.,
bioRxiv - Immunology 2022
Quote:
... Avi-tagged SARS-CoV-2 RBD and SD1-RBD (both corresponding to SARS-CoV-2 ancestral virus) were biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity). Ovalbumin (Sigma ...
-
No products found
because this supplier's products are not listed.
Alexandria N. Miller, et al.,
bioRxiv - Biophysics 2022
Quote:
SEC-purified protein [in SEC buffer containing 3 mM DM (Anatrace)] was reconstituted into liposomes ...
-
No products found
because this supplier's products are not listed.
T S Sreevidya, et al.,
bioRxiv - Biophysics 2021
Quote:
The thermal and chemical denaturation of the WT and the mutant 14-3-3 proteins were performed using nano-DSF (Prometheus NT.48) from Nanotemper Technologies (Munchen ...
-
No products found
because this supplier's products are not listed.
Victoria L. Corbit, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Virus was injected using a syringe pump (Harvard Apparatus) fitted with a syringe (Hamilton ...
-
No products found
because this supplier's products are not listed.
Christine Vazquez, Chin Yee Tan, Stacy M. Horner,
bioRxiv - Microbiology 2019
Quote:
... and rabbit anti-Sendai virus (SV) (1:1000, MBL International). Secondary antibody incubations were done with Alexa Fluor conjugated antibodies (Thermo Fisher ...
-
No products found
because this supplier's products are not listed.
Sameer Farouk Sait, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Immunodetection of RAS proteins was carried out with pan-RAS (Ab-3; Calbiochem; 1:1,000) antibodies ...
-
No products found
because this supplier's products are not listed.
Jennifer Kreis, Fee M. Wielath, Philipp Vick,
bioRxiv - Developmental Biology 2020
Quote:
... and general Reverse_5’-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCT ATTTCTAGCTCTAAAAC -3’ Embryos were injected with 1 ng Cas9 protein (PNA Bio) and 300 pg sgRNA at 1-cell stage and cultivated at room temperature until desired stage ...
-
No products found
because this supplier's products are not listed.
Supratim Basu, et al.,
bioRxiv - Plant Biology 2021
Quote:
... The agro-infiltrated leaves were analyzed for protein localization at 3 dpi under a microscope (Olympus BX51-P) equipped with a UV light source ...
-
No products found
because this supplier's products are not listed.
Emily A. Hemann, et al.,
bioRxiv - Immunology 2022
Quote:
... this virus/serum mixture is incubated with 0.5% chicken red blood cells (Rockland) and hemagglutination inhibition was measured after 30 minutes.
-
No products found
because this supplier's products are not listed.
Emma Touizer, et al.,
bioRxiv - Immunology 2022
Quote:
... (3) Non-SARS-CoV-2 antigens: Peptide pools of the pp65 protein of human cytomegalovirus (CMV) (Miltenyi Biotec, Gladbach, GER), or HIV-1 gag peptide pools (NIH AIDS Reagent Repository ...
-
No products found
because this supplier's products are not listed.
Rayhane Nchioua, et al.,
bioRxiv - Microbiology 2021
Quote:
60,000 iATII cells or Calu-3 cells were incubated for 1 h at 4°C with equal protein concentrations of control rabbit IgG (Diagenode, Cat#C15410206) or 1/200 dilution of rabbit anti-ACE2 (Abcam ...
-
No products found
because this supplier's products are not listed.
Angelino T. Tromp, et al.,
bioRxiv - Microbiology 2020
Quote:
... Samples were checked for purity and presence of protein using 15% SDS-PAGE (Polyacrylamide gel electrophoresis, Mini Protean 3 System, Bio-Rad) and Coomassie Brilliant Blue (Merck ...
-
No products found
because this supplier's products are not listed.
John K. Mich, et al.,
bioRxiv - Neuroscience 2023
Quote:
Virus injection and optic fiber implantation surgery was performed in C57BL/6J mice (The Jackson Laboratory, #000664) at around P60 ...
-
No products found
because this supplier's products are not listed.
Donatas Repecka, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... and MultiQuant 3 (Sciex) was used for analysis and quantitation of results ...
-
No products found
because this supplier's products are not listed.
JF Sturgill, et al.,
bioRxiv - Neuroscience 2020
Quote:
... AAV virus (300nL volume) was then pressure injected 100nL/min via a glass pipette pulled (P-97 Sutter Instruments) from borosilicate capillaries (Drummond calibrated 5ul ...
-
No products found
because this supplier's products are not listed.
Marion Thépaut, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Proteins were detected using InstantBlue protein stain (Expedeon) according to the supplier’s instructions.
-
No products found
because this supplier's products are not listed.
Yanqi Yu, et al.,
bioRxiv - Biophysics 2021
Quote:
... 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) was purchased from Alfa Aesar (Haverhill, MA). Nigericin sodium salt was purchased from Tocris Bioscience (Minneapolis ...