Labshake Search: find products from 1,000+ suppliers, ranked by bioRxiv citations
1 - 50 of 50
suppliers found for
CU 115 CAS 2471982 20 2 98%
» view 10000+ related products on Marketplace-
Axon Medchem Sponsored
![CU-115 - CAS [2471982-20-2], 98%](https://image.labshake.com/supplier-product/305cc4ba-a97e-4815-88b6-a95430b03ef4/4fffdb46-a682-4392-84ed-9286688538c0.png)
TLR8 inhibitor Sold for research purposes only.Cat# 3155.0, SKU# 3155-50 mg, 50mg, US $462.00 / EA, EURO, €420 / EA Ask
-
Millipore Sigma
No products found because this supplier's products are not listed.bioRxiv - Evolutionary Biology 2021Quote: ... and acetophenone (Sigma-Aldrich, CAS # 98-86-2, USA) in one experiment (Figure 6C) ... -
Quantifoil Micro Tools
No products found because this supplier's products are not listed.bioRxiv - Biophysics 2022Quote: ... R2/2 Cu 300 grids (Quantifoil) were glow-discharged for 1 min at 0.19 mbar and 20 mA in a PELCO easiGlow device ... -
Electron Microscopy Sciences
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2022Quote: ... 2 µL of particle solution (20 mg/mL) was applied on a CF400-CU grid (Electron Microscopy Sciences) for 1 min ... -
Thermo Fisher
No products found because this supplier's products are not listed.bioRxiv - Pharmacology and Toxicology 2023Quote: ... 2 μg mL−1 puromycin (58-58-2, ≥98%, Invitrogen) and 100 μg mL−1 hygromycin (31282-04-9 ... -
Merck
No products found because this supplier's products are not listed.Cited in The columnar structure of human telomeric chromatin suggests mechanisms for telomere maintenancebioRxiv - Molecular Biology 2022Quote: ... ≥ 98% (Merck), 0.1% Tween 20 (Merck) ... -
Jackson ImmunoResearch
No products found because this supplier's products are not listed.Cited in Immunofilaments Provide a Nanoscale Platform for In Vivo T Cell Expansion and Cancer ImmunotherapybioRxiv - Immunology 2022Quote: ... F(ab’)2 Fragment Specific (Jackson Immunoresearch #115-136-072) before adding IF ... -
Ted Pella
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2024Quote: ... Cu grids (Ted Pella) grids were negatively charged using a PELCO EasiGlow (Ted Pella ... -
VWR
No products found because this supplier's products are not listed.bioRxiv - Biophysics 2022Quote: ... 20% acetic acid (VWR Chemicals, 98%) solution with pH around 1.7 ... -
Agilent
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2020Quote: ... sections underwent antigen retrieval in citrate buffer (pH 6.0, 20 min at 98°C) followed by blocking of endogenous peroxidase (peroxidase block, S2023, Dako) for 10 min at room temperature (RT) ... -
Peprotech
No products found because this supplier's products are not listed.Cited in An optimized retroviral toolbox for overexpression and genetic perturbation of primary lymphocytesbioRxiv - Immunology 2021Quote: ... + 20 ng/mL IL-2 (Peprotech). 1 ml of virus-containing supernatant was added to 1 ml activated C7 cells on retronectin coated 6-well culture plates and centrifuged for 2 hours on 1000x g ... -
Santa Cruz
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2021Quote: ... Ex 527 (CAS 49843-98-3, Santa Cruz Biotechnology) was dissolved in DMSO and added to the cultured cells 24 hours before lysis to a final concentration of 1 or 10μM. -
Bio-Rad
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2024Quote: ... by boiling for 10 min at 98°C before loading onto a 4-20% gel (Bio-Rad, Hercules, CA), then transferred to PVDF 0.22 m membrane (Bio-Rad ... -
Tocris
No products found because this supplier's products are not listed.bioRxiv - Pharmacology and Toxicology 2020Quote: ... Cat. # 5274, purity ≥ 98%) and TFM-4AS-1 (CAS # 188589-61-9, Cat. # 3813, purity ≥ 98%) were purchased from Tocris Bioscience (Bristol ... -
Becton, Dickinson and Company
No products found because this supplier's products are not listed.Cited in Lipid nanoparticle topology regulates endosomal escape and delivery of RNA to the cytoplasmbioRxiv - Bioengineering 2022Quote: ... Cells were later suspended in FACS buffer (98% PBS, 2% FBS) and analyzed by flow cytometry (BD LSR-Fortessa X-20). After the sample data was acquired ... -
Invivogen
No products found because this supplier's products are not listed.bioRxiv - Immunology 2023Quote: ... CU-CPT9a (10μM; Invivogen, San Diego, CA) before subsequently treating with or without LPS ... -
Illumina
No products found because this supplier's products are not listed.Cited in Developmental dynamics of the neural crest-mesenchymal axis in creating the thymic microenvironmentbioRxiv - Immunology 2021Quote: ... (28+98) (Illumina). For the Tbx1LacZ/+Crkl+/- dataset ... -
Roche
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2020Quote: ... we added 30 μl of 20 mg/ml proteinase K (Roche 03 115 828 001). The samples were incubated overnight at 55 °C ... -
BioLegend
No products found because this supplier's products are not listed.bioRxiv - Immunology 2021Quote: ... IL-2 (20 ng/ml; BioLegend), IL-4 (20 ng/ml ... -
Miltenyi Biotec
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2024Quote: PBMCs were negatively isolated by a PBMC isolation kit (130-115-169, Miltenyi Biotec Inc., CA) from human buffy coats provided by the Hong Kong Red Cross ... -
Lonza
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2022Quote: ... program EO-115 (Lonza). RNA was purchased from Trilink or in vitro transcribed ... -
New England Biolabs
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2024Quote: ... was PCR amplified (14 cycles: 10sec 98°C, 30 sec 57°C, 20 sec 72°C) with Phusion polymerase (New England Biolabs (NEB)) ... -
abcam
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2021Quote: ... GDP (Abcam; (>98 %)) ... -
R&D Systems
No products found because this supplier's products are not listed.bioRxiv - Bioengineering 2021Quote: ... Activin-A (20 ng/mL, Miltenyi 130–115-010) and BMP4 (20 ng/mL, R&D systems 314-BP/CF) in Bovine Serum Albumin (BSA ... -
Promega
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2022Quote: ... cells were transfected in 96-well plates with 98 ng rTetR plasmid and 2 ng pRL Renilla Luciferase control reporter plasmid (Promega) to control for transfection efficiency ... -
Eppendorf
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2020Quote: ... (vi) 98°C for 2 min in a thermo-block (Eppendorf, Hamburg, Germany). Sterile DMEM treated in the similar methods served as negative controls ... -
Corning
No products found because this supplier's products are not listed.bioRxiv - Biophysics 2020Quote: ... 2 μ l of peptide diluted with 98 μ l Hank’ s Balanced Salt Solution (Corning, NY, USA) was added to and mixed with GUVs ... -
Biotium Inc.
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2020Quote: ... 20× in water (Biotium, Fremont, CA, USA), 0.5 µL of 10 µM 5× WGS_Pr_R1-5’ primer (AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTC ... -
GenScript
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020Quote: Purified 5D5 Fab and CSP 81-98 peptide (GenScript) were mixed in a 1:5 molar ratio ... -
Qiagen
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2023Quote: ... samples obtained by FACS together with 100 ng carrier RNA (PolyA- and PolyA+ mixed in 98:2 ratio) were lysed by Buffer RLT Plus (Qiagen, USA). Then we used PolyA mRNA Magnetic Isolation Module (NEBNext ... -
Molecular Devices
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... and filtered online at 2 kHz with the amplifiers 4-pole Bessel Filter and digitised at 20 kHz (Digidata1550B, Molecular Devices, CA, USA) -
Vector Labs
No products found because this supplier's products are not listed.Cited in Characterization of gustatory receptor 7 in the brown planthopper reveals functional versatilitybioRxiv - Molecular Biology 2020Quote: ... Additional biotinylated lectins (20 µg/ 50 µl; Vector Labs, Burlingame, CA) were added to each well and were incubated for 2 h at room temperature ... -
MP Biomedicals
No products found because this supplier's products are not listed.Cited in Characterization of a Biochemical Mouse Model of Primary Aldosteronism for Thermal TherapiesbioRxiv - Cancer Biology 2024Quote: ... Angiotensin II >98% purity was purchased from MP Biomedicals. Male athymic nude mice (Nu/Nu ... -
Phenomenex
No products found because this supplier's products are not listed.bioRxiv - Pharmacology and Toxicology 2023Quote: ... to 2/98% over 2:50 min:sec on a Luna™ 5 µm C18 50x2.0 mm 100 A column (Phenomenex, Aschaffenburg, Germany). For MS/MS analyses in the positive electrospray ionisation mode on a Varian 1200 TSQ (Agilent Technologies ... -
Zymo Research
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... 1 ml Proteinase K (20 mg, Zymo D3001-2-20), 9 mL water ... -
Leica
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2022Quote: ... 40 s) Quantifoil Cu 300 R2/2 grid and plunge frozen in liquid ethane with a GP2 (Leica Microsystems, Wetzlar, Germany) blotted from behind ... -
Takara Bio
No products found because this supplier's products are not listed.bioRxiv - Immunology 2022Quote: ... placed on 20 μg/mL RetroNectin (Clontech, Mountain View, CA, USA)-coated 12-well plates ... -
Sutter Instruments
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2021Quote: ... Glass capillaries (BF100-98-15, Sutter Instruments) were pulled using a needle puller (P-97 ... -
Beckman
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2021Quote: ... 2 mL of 20% (w/v) sucrose in DPBS (-Ca, -Mg) is prepared in ultracentrifuge tubes (Beckman Coulter, 344058) to which the divided EnvA- pseudotyped viral media is added before pelleting (20,000 RPM for 2 hours at 4°C) ... -
PerkinElmer
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2021Quote: ... 20 μCi/ml myo-[2-3-H(N)] inositol (PerkinElmer, MA) and indicated treatment conditions ... -
Stemcell Technologies
No products found because this supplier's products are not listed.bioRxiv - Immunology 2024Quote: ... and DNaseI (9003-98-9, STEMCELL Technologies) for 40 min at 37°C in complete HBSS (21-023-CV ... -
Gatan
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2023Quote: ... 1.2/1.3R 400 mesh Cu grids were plasma-cleaned for 30 sec in a Solarus 950 plasma cleaner (Gatan). All cryo-EM samples (2.5ul ... -
Olympus
No products found because this supplier's products are not listed.Cited in LRRK2 G2019S promotes the development of colon cancer via modulating intestinal inflammationbioRxiv - Immunology 2023Quote: ... The images were taken by fluorescent microscope (Olympus, model DP74-CU). -
GE Life Sciences
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2020Quote: ... Unbound Cu+ was removed by passage through a Sephadex G-10 column (GE Healthcare) followed by two washing steps using a 3 kDa Centricon ... -
Cell Signaling Technology
No products found because this supplier's products are not listed.bioRxiv - Immunology 2021Quote: ... r-a-hTRIF (98 kDa, Cell Signaling Technology, cat#4596) was used ... -
Sino Biological
No products found because this supplier's products are not listed.bioRxiv - Immunology 2021Quote: ... 20 μg SARS-CoV-2 RBD-his tag protein (Sino biological) in 100 μl PBS was mixed with 100 μl Complete Freund’s Adjuvant (CFA ... -
Addgene
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2024Quote: ... Pediculus humanus corporis PINK1 (115-575) was a gift from David Komander 34(Addgene plasmid # 110750). Ube1 was a gift from Cynthia Wolberger 35(Addgene plasmid # 34965). -
Biotek
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... Cells were grown at 30°C for 20 h in a microplate reader (Synergy 2, BioTek), and the optical density at 600 nm (OD600 ... -
Nikon
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: ... Cells were imaged every 2 minutes for 16-20 hours using a 40X 0.75 NA objective (Nikon). -
Carl Zeiss
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2021Quote: ... Low magnification overview images were generated with a 20× Plan-Apochromat objective (N.A. 0.8) followed by computerized image stitching with ZEN 2 software (Carl Zeiss). For z-stack high-magnification imaging ... -
Proteintech
No products found because this supplier's products are not listed.bioRxiv - Bioengineering 2023Quote: ... 20 ng/mL BMP4 (Proteintech), and 0.05 μM all-trans retinoic acid (Sigma-Aldrich ...