Labshake search
Citations for Biotium Inc. :
1 - 50 of 411 citations for CU 115 CAS 2471982 20 2 98% since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... 20× in water (Biotium, Fremont, CA, USA), 0.5 µL of 10 µM 5× WGS_Pr_R1-5’ primer (AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTC ...
-
bioRxiv - Plant Biology 2022Quote: ... 20 µM DiBAC4(3) (Biotium, Fermont, CA, USA) for membrane potential imaging (Fichman and Mittler ...
-
bioRxiv - Physiology 2024Quote: ... containing 2 μM fura-2 AM (Biotium, Inc., Fremont, CA) and 1 mg/mL BSA for 30 minutes ...
-
bioRxiv - Biochemistry 2020Quote: ... EvaGreen® dye (20×) was purchased from Biotium (Fremont, CA). TEMED ...
-
bioRxiv - Cell Biology 2021Quote: ... Hypotonic shock solution also included 20 µM FM4-64 (Biotium, Fremont, CA, USA) to stain dead protoplasts (Vida and Gerhardt ...
-
bioRxiv - Plant Biology 2021Quote: ... 2′,7′-Bis(2-carboxyethyl)-5(6)-carboxyfluorescein acetoxymethyl ester (BCECF-AM) from Biotium (CA, USA), Wortmannin (WM ...
-
bioRxiv - Plant Biology 2021Quote: ... plants were fumigated with 20 μM DiBAC4(3) (Biotium, Fermont, CA; 49–52, 64), in 1.5 mM KCl buffer for 30 min ...
-
bioRxiv - Physiology 2022Quote: ... Lipofuscin autofluorescence was reduced using TrueBlack Autofluorescence Quencher (1:20, Biotium, Fremont, CA, USA) for 60 sec ...
-
bioRxiv - Molecular Biology 2023Quote: The free radical probe 2’,7’-dichlorodihydrofluoresceindiacetate (H2DCFDA) (Biotium, Fremont, CA) was used to quantify ROS ...
-
bioRxiv - Cell Biology 2024Quote: Cell borders were labeled with 2 µg/mL WGA-640R (29026, Biotium, Fremont, CA) in appropriate cell culture media at 37°C for 15 minutes ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... After electrophoresis in a 1.5% agarose gel stained with 2% GelRed (Biotium, Hayward, CA, USA), amplicons of the expected size were sequenced on both strands by Genoscreen (Lille ...
-
CDK5 activity in retinal pigment epithelium contributes to gap junction dynamics during phagocytosisbioRxiv - Cell Biology 2023Quote: ... PCR products were electrophorized on 2% agarose gels containing GelRed® (Biotium, Fremont, CA, USA) and images were captured using the ChemiDoc(tm ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated with TrueBlack® Lipofuscin Autofluorescence Quencher (1:20 with 70% ethanol; Biotium, Fremont, CA, United States) for 30 seconds to block endogenous fluorescence signal before washing in PBS (3 x 2 mins ...
-
bioRxiv - Molecular Biology 2024Quote: ... The amplicons from each reaction were visualized on 2% agarose gel stained with RedsafeTM (Biotium, CA, USA). Capillary sequencing was performed using forward and reverse primers with the BIG dye terminator chemistry v3.1 (Applied Biosystems ...
-
bioRxiv - Evolutionary Biology 2020Quote: Aliquots (2μl) of PCR products were run for 20 minutes at 80 volts in 2% agarose gels stained with GelRedTM (Biotium) and visualized in a UV light transilluminator Alpha Imager 3400 Documentation and Analysis System (Alpha Innotech ...
-
bioRxiv - Microbiology 2021Quote: ... and the product was visualized on 2% agarose gels ran at 120V for 20 minutes and stained with GelGreen (Biotium). Primers used for probe amplification can be found in the Key Resource table..
-
bioRxiv - Evolutionary Biology 2020Quote: ... The PCR products were the run on a 2% agarose gel stained with GelRed (Biotium, Fremont, CA, USA), and visually inspected in UV lighting (Table S2 ...
-
C53 interacting with UFM1-protein ligase 1 regulates microtubule nucleation in response to ER stressbioRxiv - Cell Biology 2020Quote: ... Amplified fragments were visualized in 2% agarose gels stained by GelRed Nucleic Acid Gel Stain (Biotium, Fremont, CA). While amplification of short fragments (~ 570 bp ...
-
bioRxiv - Zoology 2024Quote: ... Amplicons were visualized on 2% agarose gels stained with GelRed Nucleic Acid Gel Stain (Biotium, Hayward, CA, USA). Positive amplicons were extracted from the gels and purified using the QIAquick gel extraction kit (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were stained with 7 μM Calcofluor White for 20 minutes and 50 μg/mL of Concanavalin A (both obtained from Biotium, Fremont CA) for 30 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... 1 mL of each fecal inoculum was mixed with 2.5 µL of 20 mM propidium monoazide (PMA) dye (Biotium, Fremont, CA, USA). The samples were then incubated in the dark for 5 min ...
-
bioRxiv - Systems Biology 2024Quote: ... 20× EvaGreen (Biotium) was employed as the fluorescent dye ...
-
bioRxiv - Bioengineering 2023Quote: ... The cell viability was documented via 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Biotium, Fremont, CA).
-
bioRxiv - Cancer Biology 2024Quote: 20 µL sample volume of PCR product was loaded on to a 2% agarose gel (BioPioneer, C0009) with GelRed (BioTium, 41003-T), combined with 6 µL dyed DNA ladder ...
-
bioRxiv - Neuroscience 2020Quote: ... USA) and the products were separated through electrophoresis on a 2% agarose gel stained with GelRed (Biotium, Fremont, CA, USA). The wild-type allele generated a single fragment of 460 bp and the mutant allele generated two fragments of 276 and 184 bp.
-
bioRxiv - Evolutionary Biology 2023Quote: ... Japan) for 2 h at room temperature and then stained with 1 μM Mito View Green solution (Biotium, Fremont, CA) and 4′,6-diamidino-2-phenylindole (DAPI ...
-
bioRxiv - Cancer Biology 2024Quote: ... Evagreen (1:20 Biotium), and 1x ROX reference dye (Invitrogen) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... All platereader experiments were performed with 20 μL volumes and the reactions were further supplemented with 2% BSA and 0.25x EvaGreen (Biotium, stock: 20x in H2O) in an optical ...
-
bioRxiv - Neuroscience 2023Quote: ... the cells were mounted using EverBrite mounting medium with 4′,6-diamidino-2-phenylindole (Cat No. 23002, Biotium, Fremont, CA, USA). Images were recorded by Olympus IX51 microscope with ToupTek camera and with the same exposure parameters (Alexa Fluor™ 555 ...
-
bioRxiv - Microbiology 2022Quote: ... The cells were then washed with PHEM-T and counter-stained with 4′,6-diamidino-2-phenylindole (DAPI, Biotium, Fremont, CA). The cells and coverslips were mounted on glass slides with Prolong Glass Antifade Mountant (Thermo Scientific) ...
-
bioRxiv - Physiology 2023Quote: ... preparations were loaded with Ca2+ (Rhod-2 AM, 50 µL of 1 mg/mL in DMSO + 10% pluronic acid, Biotium, Hayward, CA) and voltage (Vm)-sensitive dyes (RH237 ...
-
bioRxiv - Bioengineering 2024Quote: Cell proliferation was evaluated using the XTT (2,3-Bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide) assay (Biotium Inc., Fremont, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR products were separated by electrophoresis through a 2% agarose gel in 1× TBE and stained with GelRed (Biotium, Hayward, CA, USA). To confirm the sequence of each band ...
-
bioRxiv - Cell Biology 2023Quote: ... according to manufacturer’s protocol after a couple of days and CRISPR/Cas9 induced editing efficiency was analyzed by PCR and separation of amplicon on 2% agarose gel containing 1:10.000 GelRed nucleic acid gel stain (41003, Biotium Inc., Fremont, CA, USA). Amplicons were purified by MinElute Gel extraction kit (28606 ...
-
bioRxiv - Cell Biology 2022Quote: ... and rhodamine-phalloidin (1:20; Biotium) in permeabilization/blocking buffer at room temperature for 2 hours in the dark ...
-
bioRxiv - Biophysics 2021Quote: ... DPA (20 mM in DMSO; Biotium) was diluted right before use in HEK external solution (detailed below) ...
-
bioRxiv - Microbiology 2020Quote: ... Amplification products were visualized by gel electrophoresis on 2% agarose gel stained with GelRed® Nucleic Acid Gel Stain (Biotium Inc., Fremont, CA, USA).
-
bioRxiv - Cell Biology 2020Quote: ... RedDot1 (Biotium, CA, USA) was diluted 1:1000 into lysis buffer prior to adding to cells ...
-
bioRxiv - Neuroscience 2021Quote: ... and 20 μg/mL CF488A-WGA (Biotium) in the absence (control ...
-
bioRxiv - Neuroscience 2024Quote: ... and phalloidin CF488 (1:20, Biotium #00042) in the blocking solution ...
-
bioRxiv - Cell Biology 2020Quote: ... RedDot1 (Biotium, Hayward, CA, USA) was diluted (1:1000 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: MTT solution (Biotium, Hayward, CA) was diluted 1/10 in serum-free antibiotic-supplemented DMEM ...
-
bioRxiv - Microbiology 2021Quote: ... PMAxx (Biotium, Fremont, CA, USA) with a final concentration of 6uM was added ...
-
bioRxiv - Microbiology 2023Quote: ... 2.5X EvaGreen (Biotium, Fremont, CA), 0.02 U/µl Phusion polymerase (New England Biolabs ...
-
bioRxiv - Neuroscience 2023Quote: ... AM1-43 (Biotium, Fremont, CA) was diluted in sterile PBS and injected subcutaneously near the convergence of the wing and back ...
-
bioRxiv - Microbiology 2023Quote: ... 2.5X EvaGreen (Biotium, Fremont, CA), 0.02 U/µl Phusion polymerase (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: ... 1X (Biotium, Fremont, CA, USA) as per manufacturer instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... 0.5× EvaGreen (Biotium, Hayward, CA). The reaction profile consisted of 38 cycles of 94°C for 30 sec ...
-
bioRxiv - Neuroscience 2022Quote: ... Trublack (1:20 in 70% ethanol; Biotium #23007) was pipetted to cover each section for 1 minute before being rinsed off ...
-
bioRxiv - Neuroscience 2024Quote: ... Trublack (1:20 in 70% ethanol; Biotium #23007) was pipetted to cover each section for 1 minute before being rinsed off ...