-
No products found
because this supplier's products are not listed.
Tegan S. Horan, et al.,
bioRxiv - Genetics 2023
Quote:
... the cell pellet was resuspended in PBS supplemented with 2 % FCS and nucleated cells were counted in methylene blue with 3 % acetic acid on a Vi-Cell XR cell viability counter (Beckman Coulter). 10 × 106 bone marrow cells were resuspended in 200 μl of PBS supplemented with 2 % FCS containing the following antibody solution ...
-
No products found
because this supplier's products are not listed.
Astrid Kollewe, et al.,
bioRxiv - Biochemistry 2021
Quote:
... proteins fixed in 30% ethanol/15% acetic acid and the gel piece embedded in tissue embedding media (Leica). After careful mounting on a cryo-holder ...
-
No products found
because this supplier's products are not listed.
Lena H. Nguyen, et al.,
bioRxiv - Neuroscience 2021
Quote:
... using pulled borosilicate glass pipettes (4-7 MΩ resistance, Sutter Instrument) filled with an internal solution (in mM ...
-
No products found
because this supplier's products are not listed.
Kendell M Pawelec, et al.,
bioRxiv - Bioengineering 2023
Quote:
... BALB/c Mice (N=3 adult male, 7 months old; Charles River Laboratories) were used for this surgical implantation and μCT imaging pilot study ...
-
No products found
because this supplier's products are not listed.
Robin W. Yeo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... or 7 days prior to intracardiac perfusion with 4% paraformaldehyde (PFA) (Electron Microscopy Sciences, 15714) in PBS ...
-
No products found
because this supplier's products are not listed.
Madhumitha Narasimhan, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 6-Carboxy-tetramethylrhodamine succinimidyl ester (TAMRA-N-hydroxysuccinimid) was purchased from Carbosynth. Dichlormethane (DCM ...
-
No products found
because this supplier's products are not listed.
James Chen, et al.,
bioRxiv - Biophysics 2021
Quote:
... 3-([3-cholamidopropyl]dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, Anatrace) was added to the sample (8 mM final) ...
-
No products found
because this supplier's products are not listed.
Sofia Bisso, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... Methoxy-PEG succinimidyl carboxymethyl ester (Mn ≈ 2000 Da) was bought from JenKem Technology USA (Plano ...
-
No products found
because this supplier's products are not listed.
Laura E. Walls, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... and Acetic Acid Assay kits (K-ACET, Megazyme), respectively ...
-
No products found
because this supplier's products are not listed.
Minmin Sun, et al.,
bioRxiv - Immunology 2023
Quote:
... different tumor cell lines were stained with carboxyfluorescein succinimidyl ester (CFSE) following the manufacture’s protocols and cultured in X-vivo (Lonza) supplemented with 5% FBS (Gbico ...
-
No products found
because this supplier's products are not listed.
Gretel M. Torres, et al.,
bioRxiv - Immunology 2023
Quote:
... and tumors were induced one week later by topical application of 4-hydroxy-tamoxifen (0.5ug/graft in DMSO)(Peprotech) at the graft site ...
-
No products found
because this supplier's products are not listed.
Alexander M. Horspool, et al.,
bioRxiv - Microbiology 2021
Quote:
... Male and female (Figures 2-3) or male (Figures 4-7) eight-week-old B6.Cg-Tg(K18-hACE2)2Prlmn/J mice (Jackson Laboratory 034860) were anesthetized with a single intraperitoneal dose of ketamine (Patterson Veterinary 07-803-6637 ...
-
No products found
because this supplier's products are not listed.
Margarita Anisimova, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The patch electrodes (3-4 MΩ, World Precision Instruments; 1B150F-3) were filled with intracellular solution containing ...
-
No products found
because this supplier's products are not listed.
Moritz Hunkeler, Cyrus Y. Jin, Eric S. Fischer,
bioRxiv - Molecular Biology 2022
Quote:
pET21b-Caspase-3-His6 and pET21b-Caspase-7-His6 were gifts from Clay Clark (Addgene plasmid #90087) and Guy Salvesen (Addgene plasmid #11825) ...
-
No products found
because this supplier's products are not listed.
Maali AlAhmad, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 1,2-bis-(aminophenoxy)- ethane-N,N,N’,N’-tetra-acetic acid-acetoxymethyl ester (BAPTA-AM, P4758, ApexBio), (2- (Dimethylamino)-N-(6-oxo-5,6-dihydrophenanthridin-2-yl)acetamide hydrochloride (PJ34 ...
-
No products found
because this supplier's products are not listed.
Xiao-Wei Zhang, et al.,
bioRxiv - Physiology 2021
Quote:
... or pretreated with 75 μM indole-3-acetic acid (IAA, Solarbio, Beijing, China), 50 μM 1-naphthylphthalamic acid (NPA ...
-
No products found
because this supplier's products are not listed.
Lucas Tricoli, et al.,
bioRxiv - Molecular Biology 2024
Quote:
Alcian blue solution was prepared using 3% glacial acetic acid (Amresco, 0714-500) and Alcian blue 8GX (Sigma ...
-
No products found
because this supplier's products are not listed.
Jianbo Dai, et al.,
bioRxiv - Microbiology 2020
Quote:
... The caspase activities of the supernatant against substrates for caspase 8 were determined using a fluorescent assay based on the cleavage of a AMC (7-amino-4-methylcoumarin) dye from the C-terminal of specific peptide substrates (Caspase Fluorescent (AMC) Substrate/Inhibitor QuantiPak™) (BioMol International).
-
No products found
because this supplier's products are not listed.
Jason J. Northey, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... was incubated with 0.1% acetic acid (non-crosslinked; SOFT) or 0.1% acetic acid with 500 mM L-ribose (Chem Impex International, Cat. #: 28127) (cross-linked ...
-
No products found
because this supplier's products are not listed.
Aidan McGlinchey, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 3β-Hydroxy-5-cholestene-3-linoleate (ChoE(18:2)) from Larodan, were prepared to the following concentration levels ...
-
No products found
because this supplier's products are not listed.
Tobias Butelmann, et al.,
bioRxiv - Bioengineering 2021
Quote:
... glycerol and acetic acid measurements and a Rezex RPM-Monosaccharide column (Phenomenex, USA) at 80 °C with milli-Q water as mobile phase for sugars ...
-
No products found
because this supplier's products are not listed.
Ryo Konno, et al.,
bioRxiv - Biochemistry 2023
Quote:
... in 0.3% acetic acid was added to a 96-well plate (CAT# 0030128664, Eppendorf, Hamburg, Germany), sealed with plate seal (CAT# 5010-21951 ...
-
No products found
because this supplier's products are not listed.
Tolkappiyan Premkumar, et al.,
bioRxiv - Genetics 2022
Quote:
... pH 7 (SSC 20x: 3M NaCl and 0.3M citric acid trisodium salt dihydrate). For this suspension ...
-
No products found
because this supplier's products are not listed.
Weihua Zhou, et al.,
bioRxiv - Neuroscience 2020
Quote:
... C.B-17 SCID mice (female, 4-7 weeks old) were obtained from Envigo and maintained in specific pathogen-free conditions ...
-
No products found
because this supplier's products are not listed.
Eric T. Hall, et al.,
bioRxiv - Cell Biology 2020
Quote:
... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
No products found
because this supplier's products are not listed.
Geoffrey M.W. Cook, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... was acetylated with acetic acid N-hydroxysuccinimide ester (Apollo Scientific) as described64 and the product shown to be homogeneous by thin layer chromatography ...
-
No products found
because this supplier's products are not listed.
Xiangyu Zhou, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... succinyl-Leu-Leu-Val-Tyr-7-amino-4-methylcoumarin (Suc-LLVY-MCA; Peptide Institute, Cat#3120-v) in 100 mM Tris-HCl (pH 8.0 ...
-
No products found
because this supplier's products are not listed.
Xin Sun, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Carboxyfluorescein succinimidyl ester (CFSE) was purchased from Tonbo Biosciences (San Diego, CA). All other chemicals were purchased from ThermoFisher (Waltham ...
-
No products found
because this supplier's products are not listed.
Matthias Fellner, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Caspase 3-like activity was measured fluorometrically by the addition of 50 µM acetyl-Asp-Glu-Val-Asp-7-amino-4-methylcoumarin (Ac-DEVD-AMC) at 37 °C in 96-well plates using a ClarioSTAR microplate reader (BMG LABTECH). The production of AMC (λEM = 390 nm ...
-
No products found
because this supplier's products are not listed.
Sudipta Mondal, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 0.5 µCi/ml 1-14C acetic acid (American Radiolabeled Chemicals) was added to the media and grown up to mid-log phase (OD600 ∼3 ...
-
No products found
because this supplier's products are not listed.
Kevin M. Cury, Richard Axel,
bioRxiv - Neuroscience 2021
Quote:
... 40 ml of substrates containing agarose and 3% acetic acid was poured into the lid or base of a 120 mm square petri dish (Greiner) and allowed to set for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Timo Engelsdorf, et al.,
bioRxiv - Plant Biology 2019
Quote:
... extraction was performed in 10 % methanol / 1 % acetic acid with Jasmonic-d5 Acid and Salicylic-d4 Acid (CDN Isotopes) as internal standards ...
-
No products found
because this supplier's products are not listed.
Monica Gobran, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 0.5% [v/v] acetic acid and mounted on top of empty columns (Harvard Apparatus). Phosphopeptides were eluted in two steps with 40% [v/v] ACN ...
-
No products found
because this supplier's products are not listed.
Tolulope Sokoya, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and 3-azido-7-hydroxycoumarin (Jena Bioscience, CLK-FA047). LD540 dye was a kind gift from Christoph Thiele (University of Bonn ...
-
No products found
because this supplier's products are not listed.
Rafael M. Gandra, et al.,
bioRxiv - Microbiology 2023
Quote:
... Gels were destained in destaining solution (40% methanol, 10% acetic acid) and analyzed using Image Studio software (LI-COR Biosciences). Statistical analysis of densitometry was carried out with Prism 6 software (GraphPad Software ...
-
No products found
because this supplier's products are not listed.
Haiyan Li, et al.,
bioRxiv - Bioengineering 2020
Quote:
... N = 4 per group and donor) and 7 d (qualitative) with an Eclipse Ti microscope (Nikon). Four fields of view per sample were analyzed to quantify percent HTM cell viability (i.e. ...
-
No products found
because this supplier's products are not listed.
Valentina Salvi, et al.,
bioRxiv - Immunology 2021
Quote:
... and PE-conjugated anti-IL-4 (clone 7A3-3, Miltenyi Biotec) following the manufacturer’s recommendations ...
-
No products found
because this supplier's products are not listed.
Michael Jakob Pichler, et al.,
bioRxiv - Microbiology 2020
Quote:
... and sonication bath (3×10 sec at 4°C) (Bioruptor, Diagenode). Lysates were centrifuged (14.000x g ...
-
No products found
because this supplier's products are not listed.
Divyansh Gupta, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Each retina was tiled by recording 3-7 different fields of view (FOV) at 10x magnification (Olympus XLUMPLFLN20XW objective) using a sCMOS camera (Photometrics Prime 95B ...
-
No products found
because this supplier's products are not listed.
Marco Schade, et al.,
bioRxiv - Paleontology 2022
Quote:
... 2 & 3 (Figs. 1–3; Supplementary Figs. 1–4) was performed using a Metrotom 1500 (Carl Zeiss Microscopy GmbH, Jena, Germany) in a subsidiary of Zeiss in Essingen ...
-
No products found
because this supplier's products are not listed.
Marija Radosevic, et al.,
bioRxiv - Neuroscience 2019
Quote:
... The slices were incubated for 3 - 4 hr at room temperature with Cyanine-3-conjugated (Cy3) to streptavidin (1:500 or 1:250 Jackson ImmunoResearch labs, Inc) in blocking buffer (PBS with 5% donkey serum and 0.3% Triton X-100) ...
-
No products found
because this supplier's products are not listed.
Katrine Wacenius Skov Alanin, et al.,
bioRxiv - Microbiology 2021
Quote:
... 7) DC3000 − A (Illumina only), 8 ...
-
No products found
because this supplier's products are not listed.
Ziad Jowhar, et al.,
bioRxiv - Genomics 2023
Quote:
... the media was changed and fresh media with 500 μM IAA (Indole- 3-acetic acid, the most common naturally occurring Auxin hormone) (Research Products International, cat: I54000-5.0) or DMSO was added to cells ...
-
No products found
because this supplier's products are not listed.
Olivier Da Ines, et al.,
bioRxiv - Genetics 2022
Quote:
... 2 mM X-Gluc (5-bromo-4-chloro-3-indolyl-ß-D-glucuronic acid; Biosynth), dissolved in N,N-dimethylformamide) ...
-
No products found
because this supplier's products are not listed.
Huiwang Zhan, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 400mM 3-Bromopyruvic acid (BioVision, #B1045), 20 mM MitoTracker (Thermo Fisher ...
-
No products found
because this supplier's products are not listed.
Ana S Almeida, et al.,
bioRxiv - Microbiology 2021
Quote:
... and three 3–4 mm sterile glass beads (Biospec Products). Next ...
-
No products found
because this supplier's products are not listed.
Shiwei Liu, et al.,
bioRxiv - Genomics 2020
Quote:
... 7) We verified the presence of high molecular weight DNA products in the samples before purifying nucleic acids by Zymo DNA Clean & Concentrator-5 (ZYMO Research).
-
No products found
because this supplier's products are not listed.
Yuki Takamatsu, Takeshi Noda, Stephan Becker,
bioRxiv - Molecular Biology 2019
Quote:
A total of 2×104 Huh-7 cells were seeded onto a µ-Slide 4 well (Ibidi) and cultivated in DMEM/PS/Q with 10% FBS ...
-
No products found
because this supplier's products are not listed.
Charline Ogier, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... anti-TIM3 Ab (4 μg/ml, clone RMT-3-23, BioXCell, Lebanon, NH), or 25-hydroxycholesterol (4 μM ...
-
Prepared to contain collagenase and caseinase activities approximately four-fold higher than...
Cat# LS005332,
100 mg, $68.00
Ask
Federica M. Conedera, et al.,
bioRxiv - Neuroscience 2023
Quote:
Both retinas of three Csf1rGFP mice were dissected at different timepoints (Day 1, 3, and 7) and incubated with papain (Worthington Biochemical, Freehold, NJ, USA) for 15 min as previously described (26) ...